ID: 1107640909

View in Genome Browser
Species Human (GRCh38)
Location 13:42442280-42442302
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107640909_1107640911 14 Left 1107640909 13:42442280-42442302 CCAGGCTTGGTGCTAAGTGATTT No data
Right 1107640911 13:42442317-42442339 AGAATCATGCCCATGATTAAAGG No data
1107640909_1107640914 26 Left 1107640909 13:42442280-42442302 CCAGGCTTGGTGCTAAGTGATTT No data
Right 1107640914 13:42442329-42442351 ATGATTAAAGGTTTAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107640909 Original CRISPR AAATCACTTAGCACCAAGCC TGG (reversed) Intergenic
No off target data available for this crispr