ID: 1107642097

View in Genome Browser
Species Human (GRCh38)
Location 13:42454002-42454024
Sequence CCTTGAATCCAGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107642097_1107642106 9 Left 1107642097 13:42454002-42454024 CCCTCCACCTCCTGGATTCAAGG No data
Right 1107642106 13:42454034-42454056 GCCTCGGCCTCCTGAGTAGCTGG 0: 1367
1: 88932
2: 195375
3: 232005
4: 164282
1107642097_1107642110 18 Left 1107642097 13:42454002-42454024 CCCTCCACCTCCTGGATTCAAGG No data
Right 1107642110 13:42454043-42454065 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
1107642097_1107642108 10 Left 1107642097 13:42454002-42454024 CCCTCCACCTCCTGGATTCAAGG No data
Right 1107642108 13:42454035-42454057 CCTCGGCCTCCTGAGTAGCTGGG 0: 1523
1: 101544
2: 207650
3: 241638
4: 162906
1107642097_1107642112 24 Left 1107642097 13:42454002-42454024 CCCTCCACCTCCTGGATTCAAGG No data
Right 1107642112 13:42454049-42454071 GTAGCTGGGATTATAGGCACTGG 0: 52
1: 633
2: 2069
3: 3052
4: 3209
1107642097_1107642104 -7 Left 1107642097 13:42454002-42454024 CCCTCCACCTCCTGGATTCAAGG No data
Right 1107642104 13:42454018-42454040 TTCAAGGGATTCTCCTGCCTCGG 0: 81
1: 3101
2: 5745
3: 13861
4: 34501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107642097 Original CRISPR CCTTGAATCCAGGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr