ID: 1107642104

View in Genome Browser
Species Human (GRCh38)
Location 13:42454018-42454040
Sequence TTCAAGGGATTCTCCTGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57289
Summary {0: 81, 1: 3101, 2: 5745, 3: 13861, 4: 34501}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107642097_1107642104 -7 Left 1107642097 13:42454002-42454024 CCCTCCACCTCCTGGATTCAAGG No data
Right 1107642104 13:42454018-42454040 TTCAAGGGATTCTCCTGCCTCGG 0: 81
1: 3101
2: 5745
3: 13861
4: 34501
1107642099_1107642104 -8 Left 1107642099 13:42454003-42454025 CCTCCACCTCCTGGATTCAAGGG 0: 15
1: 1182
2: 17294
3: 55391
4: 116877
Right 1107642104 13:42454018-42454040 TTCAAGGGATTCTCCTGCCTCGG 0: 81
1: 3101
2: 5745
3: 13861
4: 34501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107642104 Original CRISPR TTCAAGGGATTCTCCTGCCT CGG Intergenic
Too many off-targets to display for this crispr