ID: 1107642110

View in Genome Browser
Species Human (GRCh38)
Location 13:42454043-42454065
Sequence TCCTGAGTAGCTGGGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 659312
Summary {0: 4909, 1: 66666, 2: 155807, 3: 234511, 4: 197419}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107642101_1107642110 14 Left 1107642101 13:42454006-42454028 CCACCTCCTGGATTCAAGGGATT 0: 37
1: 2638
2: 36315
3: 73633
4: 108473
Right 1107642110 13:42454043-42454065 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
1107642103_1107642110 8 Left 1107642103 13:42454012-42454034 CCTGGATTCAAGGGATTCTCCTG 0: 100
1: 6686
2: 93892
3: 169760
4: 213889
Right 1107642110 13:42454043-42454065 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
1107642097_1107642110 18 Left 1107642097 13:42454002-42454024 CCCTCCACCTCCTGGATTCAAGG No data
Right 1107642110 13:42454043-42454065 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
1107642102_1107642110 11 Left 1107642102 13:42454009-42454031 CCTCCTGGATTCAAGGGATTCTC 0: 66
1: 4158
2: 57724
3: 117544
4: 174132
Right 1107642110 13:42454043-42454065 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
1107642099_1107642110 17 Left 1107642099 13:42454003-42454025 CCTCCACCTCCTGGATTCAAGGG 0: 15
1: 1182
2: 17294
3: 55391
4: 116877
Right 1107642110 13:42454043-42454065 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107642110 Original CRISPR TCCTGAGTAGCTGGGATTAT AGG Intergenic
Too many off-targets to display for this crispr