ID: 1107642112

View in Genome Browser
Species Human (GRCh38)
Location 13:42454049-42454071
Sequence GTAGCTGGGATTATAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9015
Summary {0: 52, 1: 633, 2: 2069, 3: 3052, 4: 3209}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107642103_1107642112 14 Left 1107642103 13:42454012-42454034 CCTGGATTCAAGGGATTCTCCTG 0: 100
1: 6686
2: 93892
3: 169760
4: 213889
Right 1107642112 13:42454049-42454071 GTAGCTGGGATTATAGGCACTGG 0: 52
1: 633
2: 2069
3: 3052
4: 3209
1107642105_1107642112 -5 Left 1107642105 13:42454031-42454053 CCTGCCTCGGCCTCCTGAGTAGC 0: 1205
1: 81538
2: 180347
3: 213613
4: 152509
Right 1107642112 13:42454049-42454071 GTAGCTGGGATTATAGGCACTGG 0: 52
1: 633
2: 2069
3: 3052
4: 3209
1107642099_1107642112 23 Left 1107642099 13:42454003-42454025 CCTCCACCTCCTGGATTCAAGGG 0: 15
1: 1182
2: 17294
3: 55391
4: 116877
Right 1107642112 13:42454049-42454071 GTAGCTGGGATTATAGGCACTGG 0: 52
1: 633
2: 2069
3: 3052
4: 3209
1107642107_1107642112 -9 Left 1107642107 13:42454035-42454057 CCTCGGCCTCCTGAGTAGCTGGG 0: 1463
1: 97402
2: 203665
3: 239326
4: 165578
Right 1107642112 13:42454049-42454071 GTAGCTGGGATTATAGGCACTGG 0: 52
1: 633
2: 2069
3: 3052
4: 3209
1107642101_1107642112 20 Left 1107642101 13:42454006-42454028 CCACCTCCTGGATTCAAGGGATT 0: 37
1: 2638
2: 36315
3: 73633
4: 108473
Right 1107642112 13:42454049-42454071 GTAGCTGGGATTATAGGCACTGG 0: 52
1: 633
2: 2069
3: 3052
4: 3209
1107642097_1107642112 24 Left 1107642097 13:42454002-42454024 CCCTCCACCTCCTGGATTCAAGG No data
Right 1107642112 13:42454049-42454071 GTAGCTGGGATTATAGGCACTGG 0: 52
1: 633
2: 2069
3: 3052
4: 3209
1107642102_1107642112 17 Left 1107642102 13:42454009-42454031 CCTCCTGGATTCAAGGGATTCTC 0: 66
1: 4158
2: 57724
3: 117544
4: 174132
Right 1107642112 13:42454049-42454071 GTAGCTGGGATTATAGGCACTGG 0: 52
1: 633
2: 2069
3: 3052
4: 3209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107642112 Original CRISPR GTAGCTGGGATTATAGGCAC TGG Intergenic
Too many off-targets to display for this crispr