ID: 1107643540

View in Genome Browser
Species Human (GRCh38)
Location 13:42470256-42470278
Sequence TGTCATTTGCACAAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107643535_1107643540 29 Left 1107643535 13:42470204-42470226 CCCATATACACACAATGGAGTAC No data
Right 1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG No data
1107643537_1107643540 -2 Left 1107643537 13:42470235-42470257 CCATGAAAATGAATGAGATCCTG No data
Right 1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG No data
1107643536_1107643540 28 Left 1107643536 13:42470205-42470227 CCATATACACACAATGGAGTACT No data
Right 1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107643540 Original CRISPR TGTCATTTGCACAAGATGGA TGG Intergenic
No off target data available for this crispr