ID: 1107645024

View in Genome Browser
Species Human (GRCh38)
Location 13:42485278-42485300
Sequence ATGTATTATTACAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107645024_1107645027 15 Left 1107645024 13:42485278-42485300 CCTTCTTCTCTGTAATAATACAT No data
Right 1107645027 13:42485316-42485338 GGTGACTTACCATGCCTCACAGG No data
1107645024_1107645028 18 Left 1107645024 13:42485278-42485300 CCTTCTTCTCTGTAATAATACAT No data
Right 1107645028 13:42485319-42485341 GACTTACCATGCCTCACAGGAGG No data
1107645024_1107645025 -6 Left 1107645024 13:42485278-42485300 CCTTCTTCTCTGTAATAATACAT No data
Right 1107645025 13:42485295-42485317 ATACATTTCTTCCTGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107645024 Original CRISPR ATGTATTATTACAGAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr