ID: 1107649125

View in Genome Browser
Species Human (GRCh38)
Location 13:42526524-42526546
Sequence CAGATCAAAGAGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107649123_1107649125 -10 Left 1107649123 13:42526511-42526533 CCTGGTTCAGCAACAGATCAAAG No data
Right 1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107649125 Original CRISPR CAGATCAAAGAGAAAGAGGC AGG Intergenic
No off target data available for this crispr