ID: 1107651978

View in Genome Browser
Species Human (GRCh38)
Location 13:42553799-42553821
Sequence GCTCTATTTTACCACAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107651978_1107651980 -10 Left 1107651978 13:42553799-42553821 CCCAGACTGTGGTAAAATAGAGC No data
Right 1107651980 13:42553812-42553834 AAAATAGAGCAGAGACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107651978 Original CRISPR GCTCTATTTTACCACAGTCT GGG (reversed) Intergenic
No off target data available for this crispr