ID: 1107655639

View in Genome Browser
Species Human (GRCh38)
Location 13:42589980-42590002
Sequence GCCCGCCCACCCACCTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107655633_1107655639 -1 Left 1107655633 13:42589958-42589980 CCTGGAGGAGGAGCCCACAGATG 0: 1
1: 0
2: 8
3: 94
4: 3387
Right 1107655639 13:42589980-42590002 GCCCGCCCACCCACCTGTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 142
1107655629_1107655639 17 Left 1107655629 13:42589940-42589962 CCAACTCAGGCATTACTTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 172
Right 1107655639 13:42589980-42590002 GCCCGCCCACCCACCTGTGGGGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107655639 Original CRISPR GCCCGCCCACCCACCTGTGG GGG Intronic
900103109 1:971200-971222 CACCTCCCACCCACCTGTGCGGG - Exonic
900148475 1:1168256-1168278 GCCCTCCAGGCCACCTGTGGAGG - Intergenic
900250213 1:1665014-1665036 CCCTGCCCTCCTACCTGTGGGGG - Exonic
900261246 1:1730920-1730942 GCCCAGCCTCCTACCTGTGGTGG - Intronic
900393285 1:2443139-2443161 GCCAGCCCACCCACCTCTGGGGG - Intronic
902380103 1:16048729-16048751 GCCCCCCCTCCCCCCGGTGGGGG - Intronic
902757456 1:18558346-18558368 GCTCGCCAACCCACCTGTGCAGG + Intergenic
902763523 1:18599693-18599715 GCCAGCCCACCTGCCTGTGTAGG - Intergenic
903134843 1:21302737-21302759 GCCCGCCCTGCCCCCTTTGGAGG + Intronic
904745450 1:32707919-32707941 GCCACCACACCCAGCTGTGGGGG - Intergenic
905264601 1:36742774-36742796 GTCCACCCACCCACCCATGGTGG - Intergenic
905308812 1:37035876-37035898 GGACGCCCTCCCACCTGAGGTGG + Intergenic
905500394 1:38432070-38432092 GCCCGCCTACCCACCTCAGTTGG + Intergenic
914433600 1:147641108-147641130 GCCCGCCCAGCCTCCTCTGCAGG + Intronic
915351191 1:155227438-155227460 TCCCGCCCACGCGCCTTTGGAGG - Intergenic
916321701 1:163512157-163512179 ACCACCCCATCCACCTGTGGTGG + Intergenic
917514495 1:175696288-175696310 GCCCGCCCATTTACCTGTGGGGG - Intronic
919570516 1:199242792-199242814 CCCTGCCCACCTAGCTGTGGTGG + Intergenic
920373791 1:205495526-205495548 ACCCGCCGCCCCTCCTGTGGGGG - Intergenic
922464736 1:225839108-225839130 GCCCGCCTACCCCCAGGTGGAGG - Intronic
922795841 1:228339018-228339040 CCCCACCCACCCACCTGCTGTGG - Exonic
1069719522 10:70540733-70540755 GCCCTGCCACCCACCTGAGCTGG - Intronic
1069988684 10:72300774-72300796 GCCGGCCCACCCAGCAGTGCCGG + Intergenic
1076383576 10:130041029-130041051 CCCCTCCCACCCACCTGTCAGGG - Intergenic
1076858113 10:133127390-133127412 TCCCTCCCAGGCACCTGTGGTGG + Intronic
1077495783 11:2885951-2885973 GCGCGCACACCCACCGGGGGCGG + Intergenic
1077601215 11:3576252-3576274 GACCGTCCACCAACCTGTGTAGG + Intergenic
1079210376 11:18455790-18455812 GCCCGCCCACCCGCACGCGGGGG + Intergenic
1081111722 11:39143645-39143667 GCCACCACACCCAGCTGTGGTGG - Intergenic
1083079120 11:60073037-60073059 GCCCGGCCACCAACCTGTCTGGG - Intergenic
1084128642 11:67118069-67118091 GCCCGCGCACCCCTCCGTGGGGG + Intergenic
1088744638 11:112795359-112795381 GCCCTGCCACCTACCGGTGGTGG + Intergenic
1089572619 11:119420435-119420457 GGCCTCCCACCCACCTGAAGTGG + Intronic
1089757190 11:120695626-120695648 GCCCTGCCTCCCACCCGTGGCGG - Intronic
1091120059 11:133049862-133049884 GCCCTCCCACCCTCCTGAGGGGG - Intronic
1091793803 12:3286130-3286152 CCCTGCCCACCCACTGGTGGAGG + Exonic
1095452739 12:42349995-42350017 GCCCTCCCACCCCCCAGAGGGGG + Intronic
1096262864 12:50103925-50103947 GCCTCCCCACCCACCCCTGGAGG + Exonic
1096647654 12:53047365-53047387 GCGCGGCCACTCACCTGCGGGGG - Intronic
1101380043 12:104206530-104206552 GGCCTCCAAACCACCTGTGGTGG - Intergenic
1102253755 12:111405016-111405038 CCCCGCCCTCCCACATGTTGGGG + Intergenic
1103504593 12:121433326-121433348 GCCCGCCCGCCAGCCTGTGGAGG + Intronic
1107655639 13:42589980-42590002 GCCCGCCCACCCACCTGTGGGGG + Intronic
1118221072 14:63854514-63854536 GCCCGGCCAGCCCCCTGGGGCGG + Intronic
1124126940 15:26944978-26945000 GTCCGCCCTGCCTCCTGTGGCGG + Intronic
1124340454 15:28886502-28886524 CCCCGCCCGCCCACCCGTCGTGG - Intronic
1124635996 15:31365617-31365639 GGGGGCCCACTCACCTGTGGGGG + Intronic
1126420114 15:48463703-48463725 TCCCAACCACCCACCCGTGGTGG + Intronic
1130101616 15:80898867-80898889 TCCTGCCCACCTCCCTGTGGAGG - Intronic
1130392711 15:83473214-83473236 ACCCCCCCACCCACCTTTGGTGG - Intronic
1132376838 15:101333784-101333806 GCCCGCCCACCCACCCAGGATGG - Intronic
1132468745 16:90074-90096 GCCCGCTCACCCTCCTGGGAAGG + Intronic
1132566547 16:626113-626135 GCCCGCCCACCCACCTCGGTTGG - Exonic
1132605556 16:792363-792385 GCCCGCCCACCCACCTACCCAGG - Intronic
1132801867 16:1758542-1758564 GCCTGTCCACCCACGTGGGGAGG - Intronic
1133020045 16:2963327-2963349 GCCCTCCCACGCACCTGCGCTGG + Intergenic
1136576984 16:31130892-31130914 AGCCCCCCACCCACCTGTGATGG - Exonic
1136913506 16:34162173-34162195 GCCCGCCGACTCACATGTAGGGG - Intergenic
1137257638 16:46790082-46790104 GCCCGCTCACCCTCCCGAGGCGG - Intronic
1141882689 16:86870225-86870247 ATCCTCCCAACCACCTGTGGTGG + Intergenic
1147968910 17:44209261-44209283 GCCCATCCACCCACTTGTGCTGG - Intronic
1148225191 17:45894456-45894478 GCCCGCCCCCTCCCCTGGGGAGG + Exonic
1148240962 17:45999060-45999082 CCCCGCCCATGCACCTCTGGGGG + Intronic
1150682171 17:67292982-67293004 CCCAGCCCACCCACCTGAGAGGG - Intergenic
1152699388 17:81811580-81811602 GCCCACCCACCCACCTGCCTGGG - Intronic
1152716875 17:81904483-81904505 GACTGCCCACCCAGCTGTGGCGG - Exonic
1153051748 18:907435-907457 GCCCGCCCACCCCCCCTTCGCGG - Intronic
1153636482 18:7117606-7117628 CCCCGCCCGCCCGCCTGCGGGGG + Intronic
1156179366 18:34585109-34585131 GCTCGCCCACCCACCCATGAGGG + Intronic
1157607287 18:48933751-48933773 GCCGGCCCACCAACCTCTGTGGG + Intronic
1157666523 18:49492191-49492213 GCCGGCGCCCCCACCAGTGGAGG + Intronic
1158658182 18:59359464-59359486 CCCCGCCCACCCTCCGGGGGTGG + Exonic
1159590171 18:70325428-70325450 GCGCGCCCTCCCACTTGAGGAGG - Exonic
1160902023 19:1433515-1433537 GCCCGCCCACCCACCTCGCATGG + Intronic
1162916641 19:13877769-13877791 TCCCCCCCAGCCACCTGTGCAGG - Intronic
1163490008 19:17611925-17611947 GGCCTCCCACCCACCTGTGCTGG + Intronic
1165918060 19:39273259-39273281 GCCAGCCCAGCCAGGTGTGGTGG + Intergenic
1165927371 19:39335398-39335420 GCCCTCCCATCCTTCTGTGGGGG + Intronic
1166181619 19:41113008-41113030 GCACACCCACGAACCTGTGGGGG + Intergenic
1166945592 19:46394143-46394165 CCCCTGCCTCCCACCTGTGGGGG + Intergenic
1166948969 19:46413707-46413729 GCGCGGCCACACCCCTGTGGGGG - Intergenic
1167078008 19:47260663-47260685 GCCCGGCCTCCCTGCTGTGGAGG - Exonic
1167269257 19:48498630-48498652 GGCCGCCCCCCCACCTGGGAAGG + Exonic
1167307387 19:48716867-48716889 GCCCGCCCACCCGCCTGCACAGG - Intronic
1167437950 19:49490709-49490731 GCCCACCCACCCCACTGAGGTGG - Intronic
1168671442 19:58244048-58244070 GACCCCCCACTCACCTGGGGTGG - Exonic
925346939 2:3178295-3178317 GCCCTCCCACCCTCCTGATGTGG - Intergenic
925415310 2:3666178-3666200 TCCCAGCCACCCCCCTGTGGTGG - Intronic
925922228 2:8645587-8645609 GCCCGCCCGCCCGCCTGGGGAGG + Intergenic
929936399 2:46297294-46297316 GCCCGCCCACACACCCGCGCCGG + Intronic
929998266 2:46843195-46843217 GCCCGTCCAGTCACCTGGGGAGG + Intronic
932500827 2:72181302-72181324 GTACGACCACCCACATGTGGAGG + Intronic
932683486 2:73847689-73847711 GCCAGCTAAGCCACCTGTGGTGG + Exonic
933834264 2:86232687-86232709 GCCCGCCCAGACCCCGGTGGTGG + Exonic
935696656 2:105776497-105776519 GCTAGCCTACCCACCCGTGGAGG + Intronic
936145103 2:109975631-109975653 ACCCTCCCACCGACCTGTGCAGG - Intergenic
936199582 2:110395847-110395869 ACCCTCCCACCGACCTGTGCAGG + Intergenic
937145290 2:119639067-119639089 GCCCCCCCACCCCCCCGGGGTGG - Intronic
938097505 2:128473280-128473302 GCCCTCCCTCCTTCCTGTGGCGG + Intergenic
940259700 2:151766986-151767008 GCCTGCCCACCCCCCCGTGAAGG + Intergenic
947994715 2:234517392-234517414 TCCCGCCCACCCACCTCTCATGG - Intergenic
1170763492 20:19272122-19272144 GCCCGCCCAGCCACTGGGGGTGG + Intronic
1171810560 20:29742418-29742440 GCCCGCCGACACACACGTGGGGG + Intergenic
1175256406 20:57650357-57650379 GCCCTCCCACCCCCATGGGGAGG + Exonic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1175946189 20:62559854-62559876 GCCCTCCCACCCACAGGAGGGGG + Intronic
1176867710 21:14063184-14063206 ACCTGCCCACCCACCACTGGAGG - Intergenic
1178725964 21:35051867-35051889 CCCCGCCCCCCCACCCATGGTGG - Intronic
1179942339 21:44648322-44648344 GCCCTCCCAGCCTCCTGAGGAGG - Intronic
1181811290 22:25405188-25405210 CCGCGCCCACCTACCTGCGGCGG + Intronic
1182583157 22:31327385-31327407 GCCAGCTCACAGACCTGTGGAGG + Intronic
1184502488 22:44882538-44882560 GCCCGCCCGCCCACCCCAGGGGG + Exonic
951173895 3:19576580-19576602 GACTGCCCACCCTCCTGTGAAGG - Intergenic
954690417 3:52392700-52392722 GCCTGCCCACCCACCTGCCCCGG + Intronic
960054644 3:113268437-113268459 TCCTGCCCACTCACCTCTGGAGG - Exonic
964609664 3:158598415-158598437 GCCCCCCCACCCCCCCGTGAGGG + Intronic
967174771 3:186853162-186853184 GCCCGCCATCCAACCTGTGCAGG - Exonic
968549129 4:1213464-1213486 GCCCCCACGCCCACCTGTGATGG + Exonic
968872632 4:3249534-3249556 GCCCGCTCGCCCACCTGTACTGG - Exonic
972791455 4:42375228-42375250 GCCAGACCCCCCACCTGTGATGG + Intergenic
984966392 4:185143615-185143637 GCCCGCCCGCCCGCCCGCGGGGG + Intronic
985629820 5:1008658-1008680 CCCGGCCCGGCCACCTGTGGGGG - Intergenic
993851459 5:93015352-93015374 GCCCCCCCACCCCACTGGGGAGG - Intergenic
994054383 5:95399482-95399504 CCCCCCCCACCCACCTGTGATGG + Intronic
997453277 5:134000416-134000438 GCCTGCCCACCCACCTATCAAGG + Intronic
998200188 5:140113218-140113240 GCCCGCCCGCCCGACTGTGCGGG + Intronic
999258162 5:150221427-150221449 CACCCCCCACCCACCTCTGGGGG - Intronic
1000220550 5:159209671-159209693 TCCCGCCCACGCACCGGAGGCGG - Intronic
1002200225 5:177523921-177523943 GCCTGCTCTCCCACTTGTGGAGG - Intronic
1006740190 6:36302423-36302445 CCCTGCTCAGCCACCTGTGGAGG + Exonic
1012203726 6:96436508-96436530 TCCTGCCTCCCCACCTGTGGAGG - Intergenic
1015496648 6:133889885-133889907 GCCCGCACTCCCGCCTGCGGTGG + Intronic
1016840534 6:148520130-148520152 GCCCGCGCACCCTCCTGCCGGGG - Intronic
1020109524 7:5440188-5440210 CCCCGCTCACCCACCTGTGCGGG + Intronic
1020270106 7:6589866-6589888 GCCCGCCCAACCGCCGGTGCAGG - Intergenic
1020432275 7:8126318-8126340 TCATCCCCACCCACCTGTGGTGG - Intronic
1023877173 7:44293120-44293142 CCCTTCCCACCCACCTGTGCAGG + Intronic
1023938903 7:44757758-44757780 ACCCGCCCACCCACCCATGTGGG - Intronic
1025928242 7:65975920-65975942 GCCTGCCCATCCACCTGTCTTGG + Intronic
1026915103 7:74115477-74115499 GCGCTCCCTCCCACCTGCGGGGG - Intronic
1029139697 7:98401082-98401104 GCCCGCCCAGCTTCCTCTGGCGG - Intergenic
1029960891 7:104688558-104688580 GCCTCCCCACCCCCCTGTGGTGG + Intronic
1031720765 7:125172838-125172860 GTCCTCCTACACACCTGTGGGGG - Intergenic
1031955910 7:127942081-127942103 TCCCACCCACCAAACTGTGGAGG - Intronic
1033332752 7:140429788-140429810 GCCTGCCGAGCCTCCTGTGGGGG + Intergenic
1034198040 7:149262683-149262705 GCCCGCCCAGCCTGCTGTAGGGG - Intronic
1035286945 7:157812767-157812789 GCCCAGCTACCCATCTGTGGTGG - Intronic
1035356101 7:158276811-158276833 GGCCGCCCGCACACCTGGGGAGG - Intronic
1045192980 8:99901397-99901419 GTCCTCCTACCAACCTGTGGTGG + Intergenic
1049442297 8:142614930-142614952 CCCCGCCCACCCAGCTCTGCAGG + Intergenic
1051233779 9:14978226-14978248 GCTCGCCCACCCACCCTAGGGGG + Intergenic
1059710769 9:116865705-116865727 GCCCACCCACCCACCAGCTGTGG - Intronic
1060405650 9:123371717-123371739 GCCCTGCCACCCTCCTGTAGTGG - Intronic
1061606657 9:131716019-131716041 GCCCGCCGACCCACGTCTGCAGG + Intronic
1203760071 EBV:8160-8182 GCCCGCCCACCTACTTATGCAGG + Intergenic
1196351231 X:114733115-114733137 CCGCGCCCGGCCACCTGTGGTGG - Intronic
1201077608 Y:10199366-10199388 GCCCGCCGACACACATGTGGGGG - Intergenic