ID: 1107656419

View in Genome Browser
Species Human (GRCh38)
Location 13:42596365-42596387
Sequence CTTGACTGGCATCTGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107656419_1107656425 9 Left 1107656419 13:42596365-42596387 CCAGCAGCCAGATGCCAGTCAAG 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1107656425 13:42596397-42596419 CTTTTCAGAGTTACTGCTTCAGG 0: 1
1: 0
2: 0
3: 19
4: 219
1107656419_1107656427 13 Left 1107656419 13:42596365-42596387 CCAGCAGCCAGATGCCAGTCAAG 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1107656427 13:42596401-42596423 TCAGAGTTACTGCTTCAGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 164
1107656419_1107656426 10 Left 1107656419 13:42596365-42596387 CCAGCAGCCAGATGCCAGTCAAG 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1107656426 13:42596398-42596420 TTTTCAGAGTTACTGCTTCAGGG 0: 1
1: 0
2: 4
3: 26
4: 274
1107656419_1107656430 27 Left 1107656419 13:42596365-42596387 CCAGCAGCCAGATGCCAGTCAAG 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1107656430 13:42596415-42596437 TCAGGGAGGGAGTCACGCTAGGG 0: 1
1: 0
2: 1
3: 8
4: 80
1107656419_1107656429 26 Left 1107656419 13:42596365-42596387 CCAGCAGCCAGATGCCAGTCAAG 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1107656429 13:42596414-42596436 TTCAGGGAGGGAGTCACGCTAGG 0: 1
1: 0
2: 1
3: 10
4: 151
1107656419_1107656428 14 Left 1107656419 13:42596365-42596387 CCAGCAGCCAGATGCCAGTCAAG 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1107656428 13:42596402-42596424 CAGAGTTACTGCTTCAGGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107656419 Original CRISPR CTTGACTGGCATCTGGCTGC TGG (reversed) Intronic
901558730 1:10052568-10052590 CTTCACAGGCATGTGACTGCAGG + Intronic
901626846 1:10629569-10629591 CTTGACTGGGATCTGCCAGGAGG - Exonic
903005015 1:20292759-20292781 CTTGGCTGGCATCTGTCTGCAGG + Intronic
908798040 1:67851003-67851025 CCTGAATGGAATGTGGCTGCCGG + Intergenic
910561530 1:88597217-88597239 CTTGACTGGCAACTGCCTCAGGG - Intergenic
912661555 1:111535960-111535982 CTGGGCTGGAAGCTGGCTGCTGG - Intronic
914901602 1:151714129-151714151 CTAGATTGGCATCTCGGTGCTGG - Intronic
916476401 1:165173521-165173543 CTTGCCTGCCTGCTGGCTGCTGG - Intergenic
923154957 1:231270166-231270188 CCTGCCTGGCAGCTGTCTGCAGG + Intronic
924909019 1:248489025-248489047 TTTTCCTGGCATCGGGCTGCTGG + Exonic
924915086 1:248559033-248559055 TTTTCCTGGCATCGGGCTGCTGG - Exonic
1062985243 10:1762243-1762265 CCTGAACGGCATCTGGCTGCTGG - Intergenic
1063075320 10:2710913-2710935 GGTGACTGGCATCTTGCAGCTGG - Intergenic
1063295103 10:4797289-4797311 TGTGACTGGCTTCTGGGTGCAGG + Intronic
1065782635 10:29184404-29184426 CTTTACAGGCATCTGACTGATGG + Intergenic
1067553287 10:47250003-47250025 AGTGCCTTGCATCTGGCTGCGGG - Intergenic
1067938247 10:50629689-50629711 CCTGACTGGCATCAGACTCCTGG + Intergenic
1068943834 10:62708128-62708150 CTTCACTGGTATTAGGCTGCAGG - Intergenic
1069567362 10:69472757-69472779 TTTGCGTGGCATCTGGCTTCAGG + Intronic
1069723032 10:70561649-70561671 CCTCACTGGCCTCTGTCTGCAGG + Intronic
1069910913 10:71758607-71758629 CATAGCTGGGATCTGGCTGCAGG - Intronic
1071767565 10:88685664-88685686 CTTGACATGCATCTGGCAGAAGG - Intergenic
1073468540 10:103708566-103708588 AGGGACTGGCACCTGGCTGCAGG - Intronic
1073839429 10:107481570-107481592 CTACACTGGCATCTGACTGTGGG - Intergenic
1073886945 10:108050249-108050271 CCAGACTGGCATATGGCTGCTGG + Intergenic
1074650854 10:115523026-115523048 CCTCACTAGCATCTGTCTGCAGG + Intronic
1074987808 10:118672906-118672928 CTAGACTGGGCTCTGTCTGCAGG + Intergenic
1076122825 10:127949981-127950003 CTTGCCTGGCAACTGGCTCAGGG - Intronic
1076273696 10:129178448-129178470 CTTCCCTGGCATCTGCCTTCTGG + Intergenic
1076927743 10:133501701-133501723 CTTGCCTGGCATCTGCCTCAGGG + Intergenic
1077251405 11:1562248-1562270 CTTTCCTGGGATCTGCCTGCAGG + Intronic
1077586344 11:3456526-3456548 CTTTACGGGTATCTGGCTGGGGG + Intergenic
1079282411 11:19099238-19099260 TTTTACTGGGATCTGGTTGCAGG - Intergenic
1079349197 11:19678398-19678420 CATGCCTGTCATCTCGCTGCAGG + Intronic
1081758062 11:45558773-45558795 CTTGACTGGGTTCTAGCTGCAGG + Intergenic
1083603825 11:63965111-63965133 CATGATTGGCTTCTGGATGCTGG - Intergenic
1085415630 11:76317487-76317509 CTTGGCTGGCCTCCAGCTGCTGG + Intergenic
1085450197 11:76627279-76627301 CTTGACTGGCATCTGGCACATGG - Intergenic
1086727294 11:90203381-90203403 CATGACTGGCATCAGACTGGAGG - Exonic
1087731771 11:101786627-101786649 CTTGACTGGGATCTGGATTTTGG - Intronic
1089890224 11:121873330-121873352 TTTGCCTGGCATCTGTGTGCAGG + Intergenic
1091580095 12:1780985-1781007 CTTGATTGTCATCTGTGTGCTGG + Exonic
1095943694 12:47741570-47741592 CACCACGGGCATCTGGCTGCAGG + Exonic
1096448496 12:51716927-51716949 CTTGTCTGGTATCTGGCTATGGG - Intronic
1101448312 12:104754190-104754212 CTTCTCTGGAATCTGGCTGAGGG + Intronic
1102280463 12:111614827-111614849 CATGTCTGGCAACTGGCTGTTGG + Intergenic
1104172297 12:126293634-126293656 GTAGGCTGGCATCTGTCTGCAGG - Intergenic
1106925031 13:34605069-34605091 CATGACTGGCAAGGGGCTGCTGG + Intergenic
1107490143 13:40873869-40873891 CTTGCCTGGCAACTGGCTCAGGG - Intergenic
1107656419 13:42596365-42596387 CTTGACTGGCATCTGGCTGCTGG - Intronic
1108432530 13:50368585-50368607 CTAGACTGGCAGCTGGGTGCTGG - Intronic
1113905225 13:113816341-113816363 CATCACTGCCATCTGGCTCCCGG - Exonic
1117945942 14:61021296-61021318 CTAGACCGGCATCTAGCTTCAGG + Intronic
1118645638 14:67836230-67836252 CATGACTGGCAAATGGGTGCTGG + Intronic
1120918937 14:89737247-89737269 CATGACTGGCATCAGACTGGAGG - Intergenic
1121043921 14:90774298-90774320 CTTCAGTGGCAGCTGGCTTCAGG - Intronic
1121112036 14:91319118-91319140 CTCGACTGGAATCTGACAGCTGG + Intronic
1122549869 14:102544152-102544174 CTTTGCTGGCATCTGGGGGCTGG - Intergenic
1202850239 14_GL000225v1_random:12270-12292 CTTGACTGGGCTCTGCCTACAGG - Intergenic
1202861393 14_GL000225v1_random:84570-84592 CTTGTCTGGGATCTGCCTACAGG + Intergenic
1202869137 14_GL000225v1_random:143631-143653 CTTGTCTGGGCTCTGCCTGCAGG + Intergenic
1124368618 15:29090857-29090879 CTTTTATGGCATCTGGCTGTGGG - Intronic
1127963183 15:63905447-63905469 GGTGCCTGGCTTCTGGCTGCTGG + Intergenic
1128216130 15:65935382-65935404 TTTGACTGGCATCTGAAGGCAGG + Intronic
1128298552 15:66546654-66546676 CTTGAAATGCACCTGGCTGCAGG - Exonic
1128451356 15:67807527-67807549 CTTACCTGGCATGTGGCTGAGGG - Intergenic
1129699450 15:77759227-77759249 CTTCACTGGCCTCTGGCTTGAGG + Intronic
1129995834 15:80004269-80004291 CTTGGCTGGTACCTGGATGCAGG - Intergenic
1131464497 15:92644611-92644633 CTTGACTGGTGACTGGGTGCTGG - Intronic
1131614026 15:93994889-93994911 TTTGACTCCCATCTGGCTGGGGG + Intergenic
1132702665 16:1228763-1228785 GGTGAATGGCACCTGGCTGCAGG - Exonic
1132705661 16:1242105-1242127 GGTGAATGGCACCTGGCTGCAGG + Exonic
1133570273 16:7033828-7033850 CTAGAGTGGCATCTGCCTGTGGG + Intronic
1135187764 16:20329892-20329914 GTACACTGGCCTCTGGCTGCAGG - Intergenic
1136922906 16:34346332-34346354 CTTGCCTTGCATCTGGCTGAAGG + Intergenic
1136981667 16:35065474-35065496 CTTGCCTTGCATCTGGCTGAAGG - Intergenic
1137561441 16:49504911-49504933 CTGGACTGGCCTATGACTGCAGG - Intronic
1137568503 16:49549365-49549387 CTTCCCTGCCATCTGGCTGGAGG - Intronic
1138076605 16:54049034-54049056 AGTCAGTGGCATCTGGCTGCTGG - Intronic
1139813952 16:69651566-69651588 CTTCACAGTCATCTGGCTCCTGG + Intronic
1140858771 16:79001121-79001143 CCTGACTGGCACCTGGATGTGGG - Intronic
1141400175 16:83740591-83740613 TCTGACTGGCATATGGCAGCTGG - Intronic
1141698437 16:85631586-85631608 TGGGACTGGCATCTGCCTGCTGG + Intronic
1145216786 17:21058821-21058843 TTTGACTGGCATGTGGCTTAGGG - Intergenic
1145247438 17:21278821-21278843 CTTGACTGCCTCCTGCCTGCTGG + Intergenic
1147122347 17:38343237-38343259 CTTGTCTGGGAACTGGGTGCAGG - Exonic
1148091124 17:45023040-45023062 CTTAATAGGCTTCTGGCTGCAGG + Intergenic
1148569450 17:48656507-48656529 CCTTACTGGCCTCAGGCTGCAGG - Intergenic
1150812142 17:68364931-68364953 CTAGCCTGGCATCAGGATGCAGG + Intronic
1152965322 18:109190-109212 CTTGACTAGGATCTGCCTACAGG + Intergenic
1153191000 18:2538521-2538543 CTTTCCTGGCATCAGTCTGCAGG - Exonic
1153231880 18:2945828-2945850 CATGACTGGCATCAGACTGGAGG - Intronic
1153255070 18:3162319-3162341 CTTGCCTGGTATCTGGCCCCGGG - Intronic
1153841814 18:9014699-9014721 CTTGACTCCCACCTGGGTGCTGG - Intergenic
1155507100 18:26545124-26545146 GTCTACTGGCATCTGTCTGCTGG - Intronic
1156057943 18:33033437-33033459 CTTCCCTGGCATCTGGCTTAAGG + Intronic
1156126298 18:33909717-33909739 CTAGACGGTCATCTGGGTGCTGG + Intronic
1160044637 18:75375495-75375517 CTTGGGTGTCCTCTGGCTGCGGG + Intergenic
1160385641 18:78494750-78494772 CTTGGCTGCCATCTGCCTTCAGG - Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1160939779 19:1614843-1614865 CTTGCGTGGCATCTGCCTGACGG + Intronic
1161239385 19:3213536-3213558 CATAACTGTCCTCTGGCTGCCGG - Intergenic
1161271602 19:3392724-3392746 CTGGCCTGGCAGCTGGCTGGAGG - Intronic
1161373539 19:3927274-3927296 CCTGGCTGGCATCTATCTGCTGG - Exonic
1164486996 19:28666993-28667015 CTTGAGTGAGATCTGGCTGTAGG - Intergenic
1165357695 19:35313796-35313818 CTAGACTGGCATTTGGCTTTGGG - Exonic
1166832195 19:45645456-45645478 CTCGCCTGGCATCAGGCGGCCGG + Exonic
925388506 2:3479954-3479976 TTTGGCTGGCATCAGGCTGGAGG - Intronic
926216450 2:10908539-10908561 CTCCCCTGGCTTCTGGCTGCAGG + Intergenic
926760290 2:16272515-16272537 CTAGAATGGCATCTGGCATCAGG - Intergenic
927976431 2:27342100-27342122 CTGGACAGGCTGCTGGCTGCCGG + Exonic
929932658 2:46270959-46270981 CTTCACTGGCATGTGAATGCTGG + Intergenic
933186874 2:79288528-79288550 CATTCCTGGCATCTGGCTTCTGG + Intronic
933947613 2:87300204-87300226 CCTGACAAGCAGCTGGCTGCAGG + Intergenic
936332583 2:111561373-111561395 CCTGACAAGCAGCTGGCTGCAGG - Intergenic
937211468 2:120275107-120275129 CTTGTCTGGGCTCTGGCTGTAGG - Intronic
937325969 2:120989720-120989742 CTTGGCTGGCATGTTGCTGCAGG - Exonic
937417887 2:121731419-121731441 CTTCACTGGCTTCTTTCTGCAGG + Intronic
937857459 2:126682833-126682855 CTTGGTCAGCATCTGGCTGCTGG - Intronic
938213762 2:129490859-129490881 CATGACTGGCACATGGATGCTGG - Intergenic
939367988 2:141259532-141259554 CTTGTCAGCCATCTGGGTGCAGG + Intronic
940055619 2:149509866-149509888 CCTCACTGGCATGTGGCTGGAGG + Intergenic
940289249 2:152062306-152062328 CTGGACTGGCCTCTGGCTGAGGG - Intronic
946021132 2:216640900-216640922 CTTGACTGACCTCTGTATGCTGG - Intronic
947113563 2:226745820-226745842 CTTGCCTGGCATTTGGTTGGTGG - Intronic
948446087 2:238034065-238034087 TTTAACTGGCAACTTGCTGCAGG + Intronic
1169999687 20:11601343-11601365 GTTGTCTGGTATCTGGCTCCAGG + Intergenic
1170197372 20:13703144-13703166 CTTGATGGGAATCTGGCTTCTGG + Intergenic
1175483457 20:59327609-59327631 CTTTTCTGGCATCTGGGTGGAGG + Intergenic
1177002952 21:15636029-15636051 CTTGCCTGGCAGCTGCCTCCGGG + Intergenic
1178831411 21:36060072-36060094 CCTGGCTGGCCTATGGCTGCGGG - Exonic
1180855839 22:19044225-19044247 CTGGGCTGGCCTCTGGCTTCTGG - Intronic
1182074877 22:27488554-27488576 CTTGGGTGGCATCTGGCTTCTGG - Intergenic
1183054328 22:35293726-35293748 CTTCAGTGGCCTCTGGCTGTAGG + Exonic
1184646441 22:45897815-45897837 CCTCACTGGCACCTGGCTCCAGG + Intergenic
1184652238 22:45924725-45924747 CTAGACTGGCAGGTGGGTGCCGG + Intronic
949419268 3:3848451-3848473 CTTGTCTGGCACCTGTCTGATGG - Intronic
950458257 3:13105393-13105415 CCTGAGCGGCATCTGTCTGCTGG - Intergenic
956800179 3:72750451-72750473 CCTGACTGGCATCAGACTCCTGG + Exonic
957667869 3:83258534-83258556 TTTTACTAGTATCTGGCTGCTGG - Intergenic
958016299 3:87943141-87943163 CTACACTGGCAACTGCCTGCTGG + Intergenic
962677805 3:137769306-137769328 CTTGGCTGCCATCTGGCTCAGGG + Intergenic
964014069 3:151925411-151925433 TTTGACTTGTATTTGGCTGCTGG - Intergenic
964866168 3:161264279-161264301 CCTGAGTGGGTTCTGGCTGCTGG + Intergenic
966985995 3:185180960-185180982 CTTGACTTGCTTTTGGCTGTGGG - Intergenic
969401993 4:6961798-6961820 CGCGACTGGCATCTGTCTGCAGG + Intronic
971248681 4:24953176-24953198 CTTCTCTAGCATCTGGCTGGGGG + Intronic
972462136 4:39314640-39314662 CAAGACTGGCATCTTCCTGCAGG + Intronic
975306976 4:72861065-72861087 CTTGACTGGAATCTAGTAGCTGG - Intergenic
978342159 4:107730089-107730111 CTTGACTGGCAACTGCCTCAGGG + Intergenic
981441019 4:144782029-144782051 TTTGCCTGGCATCTGGCATCTGG - Intergenic
983626148 4:169803785-169803807 TTTGACTGGTGTCTGGCTGGAGG + Intergenic
987152845 5:15059186-15059208 CTTGCCTGGCAGCTGCCTGAGGG - Intergenic
989908955 5:49599580-49599602 CTTGTCTAGCATCTGCCTACAGG - Intergenic
990678225 5:58212749-58212771 CTTGATTGGCATCTGCTTCCTGG - Intergenic
994665178 5:102696590-102696612 CTTCATTGGCATCTGGTTTCAGG + Intergenic
994758066 5:103818862-103818884 CTTGGCTTGCAGATGGCTGCTGG - Intergenic
994836812 5:104865660-104865682 CTTGACTGGCAACTGCCTCAAGG - Intergenic
999570280 5:152912359-152912381 CTTTACTTGCATGTGCCTGCAGG - Intergenic
1000161039 5:158598060-158598082 CTGGAATGGCAGCTGGCTTCTGG + Intergenic
1001082383 5:168676875-168676897 CCTGCCTGGCAGCTGGCTCCAGG + Intronic
1002896028 6:1380874-1380896 CTTGGCTTTCTTCTGGCTGCTGG - Intergenic
1004829095 6:19458212-19458234 ATAGACTGTCATCTAGCTGCAGG + Intergenic
1008567135 6:52780424-52780446 GTTAAATGGCATCTGGCTGGTGG - Intergenic
1009857722 6:69285862-69285884 CTAGACTGGCATCTGTCTACAGG - Intronic
1010472644 6:76247694-76247716 CTTGACTTGAGTCTGGCAGCAGG - Intergenic
1011041826 6:83037933-83037955 CTTGGCTGCCATCTGGCTCGGGG - Intronic
1012147766 6:95707823-95707845 CATGACTGACATTTGGCTCCTGG - Intergenic
1012874764 6:104713097-104713119 CCTGACTGGGGTCTGGTTGCTGG + Intergenic
1012921121 6:105221969-105221991 CTTGCCTGGCAACTGGCTCAGGG + Intergenic
1015548774 6:134390042-134390064 CATGCCTGCCATCTGGATGCTGG + Intergenic
1018720031 6:166565436-166565458 CCTCCCTGGCACCTGGCTGCAGG + Intronic
1022296154 7:29055690-29055712 CTGGGCTGGCAGCTGGCAGCTGG - Intronic
1023520498 7:41045831-41045853 CTAGAATGGCATCTGTCTCCTGG + Intergenic
1023991314 7:45130419-45130441 CTTGCCTGTCATCTGGGTTCAGG + Intergenic
1024557770 7:50618085-50618107 TTTGACTGCCATTTGACTGCTGG + Exonic
1026946414 7:74319098-74319120 CTTGTCTGGCTTCTCACTGCTGG - Intronic
1028118516 7:87029357-87029379 ATGCACTGGCATCTGGCTCCTGG + Intronic
1028588624 7:92474548-92474570 CTAGACTGGGAACTGCCTGCTGG + Intronic
1029232872 7:99086016-99086038 CTTGATTTGCATCTGCCTGATGG - Intronic
1030277128 7:107733615-107733637 CTTGCCTGGCAACTGCCTGAGGG - Intergenic
1037754148 8:21700566-21700588 CTCGACTGCCAACTGGCTGTGGG + Intronic
1040817140 8:51520363-51520385 GTGGACTGGAACCTGGCTGCGGG + Intronic
1042880884 8:73487329-73487351 CTTGACTGGCATGTGAGTGAGGG + Intronic
1043632925 8:82359285-82359307 CTTAACTGAAATGTGGCTGCAGG + Intergenic
1046253653 8:111667049-111667071 CTTGACAGGATTCTGGCTGAAGG - Intergenic
1046309823 8:112420677-112420699 TTTTACTGGCATCTAGCTGTTGG + Intronic
1047104416 8:121717754-121717776 CATGCCTGGCTTCTGGTTGCTGG - Intergenic
1047443916 8:124902846-124902868 CTACACTGGCAACTGCCTGCTGG + Intergenic
1050360763 9:4828889-4828911 CTTGGTTGGTATCTGGCTCCAGG + Intronic
1057223191 9:93268724-93268746 CTTGGCTGGCTTCTGGCGGCAGG - Exonic
1057721790 9:97537466-97537488 CTTTACTGGCACCTGTTTGCAGG + Intronic
1057779435 9:98037495-98037517 CTTGCCTGGCTACTGTCTGCAGG - Intergenic
1058539320 9:105995184-105995206 ATTGGCTGGCTTCTGGCAGCTGG - Intergenic
1059230968 9:112721280-112721302 CTTGACTGGCAACTTGGTGCTGG - Intergenic
1060872746 9:127055907-127055929 CTGGCCTGGCACCTGGTTGCTGG + Intronic
1060940806 9:127541940-127541962 CTTGACTGGCCCCTGGGTGCTGG - Intronic
1203735736 Un_GL000216v2:137511-137533 CTTGTCTGGGCTCTGCCTGCAGG - Intergenic
1189066325 X:37813185-37813207 CTAGGCTGGCAGCTGGCTGCTGG - Exonic
1189292505 X:39896130-39896152 CAGGACTGGCCTCAGGCTGCAGG + Intergenic
1190113378 X:47609646-47609668 CCTCACTGCCATCTGGCTGCTGG - Intronic
1194604719 X:95964483-95964505 CTTGACTGGCAACTGCCTCAGGG + Intergenic
1195888099 X:109662508-109662530 CCTGACTGGGATCTTGCTGAGGG + Intronic
1197529538 X:127606058-127606080 CTTGCCTGGCAACTGCCTGAGGG - Intergenic
1201124907 Y:10903979-10904001 CTTGTCTGGGATCTGCCTGCAGG + Intergenic
1201125464 Y:10909872-10909894 CTTGTCTAGGATCTGCCTGCAGG + Intergenic
1201125643 Y:10911584-10911606 CTTGTCTGGGATCTGCCTACAGG - Intergenic
1201126163 Y:10916475-10916497 CTTGTCTGGGATCTGCCTGCAGG + Intergenic
1202624058 Y:56839591-56839613 CTTGTCTGGGATCTGCCTACAGG + Intergenic
1202624582 Y:56844295-56844317 CTTGTCTGGGATCTGCCTACGGG + Intergenic
1202624920 Y:56847384-56847406 CTTGTCTGGGATCTGCCTACAGG + Intergenic