ID: 1107659185

View in Genome Browser
Species Human (GRCh38)
Location 13:42621750-42621772
Sequence AAGCAGAAGAGAAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107659182_1107659185 -8 Left 1107659182 13:42621735-42621757 CCTTTCTCTCTTCTAAAGCAGAA No data
Right 1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107659185 Original CRISPR AAGCAGAAGAGAAAGGAGGA AGG Intergenic
No off target data available for this crispr