ID: 1107659836

View in Genome Browser
Species Human (GRCh38)
Location 13:42627358-42627380
Sequence TTCTCTTATTAAATATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107659836_1107659842 9 Left 1107659836 13:42627358-42627380 CCAAGAAATATTTAATAAGAGAA No data
Right 1107659842 13:42627390-42627412 GAGAGAGTCATCATTTTCAGTGG No data
1107659836_1107659843 10 Left 1107659836 13:42627358-42627380 CCAAGAAATATTTAATAAGAGAA No data
Right 1107659843 13:42627391-42627413 AGAGAGTCATCATTTTCAGTGGG No data
1107659836_1107659844 11 Left 1107659836 13:42627358-42627380 CCAAGAAATATTTAATAAGAGAA No data
Right 1107659844 13:42627392-42627414 GAGAGTCATCATTTTCAGTGGGG No data
1107659836_1107659846 29 Left 1107659836 13:42627358-42627380 CCAAGAAATATTTAATAAGAGAA No data
Right 1107659846 13:42627410-42627432 TGGGGGCTATACTAGTCGTGAGG No data
1107659836_1107659845 12 Left 1107659836 13:42627358-42627380 CCAAGAAATATTTAATAAGAGAA No data
Right 1107659845 13:42627393-42627415 AGAGTCATCATTTTCAGTGGGGG No data
1107659836_1107659847 30 Left 1107659836 13:42627358-42627380 CCAAGAAATATTTAATAAGAGAA No data
Right 1107659847 13:42627411-42627433 GGGGGCTATACTAGTCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107659836 Original CRISPR TTCTCTTATTAAATATTTCT TGG (reversed) Intergenic