ID: 1107659847

View in Genome Browser
Species Human (GRCh38)
Location 13:42627411-42627433
Sequence GGGGGCTATACTAGTCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107659836_1107659847 30 Left 1107659836 13:42627358-42627380 CCAAGAAATATTTAATAAGAGAA No data
Right 1107659847 13:42627411-42627433 GGGGGCTATACTAGTCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107659847 Original CRISPR GGGGGCTATACTAGTCGTGA GGG Intergenic