ID: 1107666510

View in Genome Browser
Species Human (GRCh38)
Location 13:42696273-42696295
Sequence GAGCCGATGTGAGACAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107666505_1107666510 14 Left 1107666505 13:42696236-42696258 CCCAGCCCACTGGAGGTTCAGAG No data
Right 1107666510 13:42696273-42696295 GAGCCGATGTGAGACAAGCCTGG No data
1107666506_1107666510 13 Left 1107666506 13:42696237-42696259 CCAGCCCACTGGAGGTTCAGAGC No data
Right 1107666510 13:42696273-42696295 GAGCCGATGTGAGACAAGCCTGG No data
1107666508_1107666510 8 Left 1107666508 13:42696242-42696264 CCACTGGAGGTTCAGAGCCACAC No data
Right 1107666510 13:42696273-42696295 GAGCCGATGTGAGACAAGCCTGG No data
1107666509_1107666510 -9 Left 1107666509 13:42696259-42696281 CCACACAGAGCAGAGAGCCGATG No data
Right 1107666510 13:42696273-42696295 GAGCCGATGTGAGACAAGCCTGG No data
1107666507_1107666510 9 Left 1107666507 13:42696241-42696263 CCCACTGGAGGTTCAGAGCCACA No data
Right 1107666510 13:42696273-42696295 GAGCCGATGTGAGACAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107666510 Original CRISPR GAGCCGATGTGAGACAAGCC TGG Intergenic
No off target data available for this crispr