ID: 1107671390

View in Genome Browser
Species Human (GRCh38)
Location 13:42749941-42749963
Sequence GATGGTAAACAGCAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107671390_1107671394 -4 Left 1107671390 13:42749941-42749963 CCATCCTGCTGCTGTTTACCATC No data
Right 1107671394 13:42749960-42749982 CATCCCATATGCCAAAGCAAGGG No data
1107671390_1107671393 -5 Left 1107671390 13:42749941-42749963 CCATCCTGCTGCTGTTTACCATC No data
Right 1107671393 13:42749959-42749981 CCATCCCATATGCCAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107671390 Original CRISPR GATGGTAAACAGCAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr