ID: 1107671461

View in Genome Browser
Species Human (GRCh38)
Location 13:42750468-42750490
Sequence CCTGGTAAGGTACAGACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107671461_1107671469 11 Left 1107671461 13:42750468-42750490 CCCAGGGTCTGTACCTTACCAGG No data
Right 1107671469 13:42750502-42750524 TCAGCTTTGGTTCTTCAAGTGGG No data
1107671461_1107671470 12 Left 1107671461 13:42750468-42750490 CCCAGGGTCTGTACCTTACCAGG No data
Right 1107671470 13:42750503-42750525 CAGCTTTGGTTCTTCAAGTGGGG No data
1107671461_1107671466 -2 Left 1107671461 13:42750468-42750490 CCCAGGGTCTGTACCTTACCAGG No data
Right 1107671466 13:42750489-42750511 GGCCTTCTTTTCATCAGCTTTGG No data
1107671461_1107671471 15 Left 1107671461 13:42750468-42750490 CCCAGGGTCTGTACCTTACCAGG No data
Right 1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG No data
1107671461_1107671468 10 Left 1107671461 13:42750468-42750490 CCCAGGGTCTGTACCTTACCAGG No data
Right 1107671468 13:42750501-42750523 ATCAGCTTTGGTTCTTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107671461 Original CRISPR CCTGGTAAGGTACAGACCCT GGG (reversed) Intergenic
No off target data available for this crispr