ID: 1107671464

View in Genome Browser
Species Human (GRCh38)
Location 13:42750481-42750503
Sequence GATGAAAAGAAGGCCTGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107671464_1107671470 -1 Left 1107671464 13:42750481-42750503 CCTTACCAGGCCTTCTTTTCATC No data
Right 1107671470 13:42750503-42750525 CAGCTTTGGTTCTTCAAGTGGGG No data
1107671464_1107671468 -3 Left 1107671464 13:42750481-42750503 CCTTACCAGGCCTTCTTTTCATC No data
Right 1107671468 13:42750501-42750523 ATCAGCTTTGGTTCTTCAAGTGG No data
1107671464_1107671469 -2 Left 1107671464 13:42750481-42750503 CCTTACCAGGCCTTCTTTTCATC No data
Right 1107671469 13:42750502-42750524 TCAGCTTTGGTTCTTCAAGTGGG No data
1107671464_1107671471 2 Left 1107671464 13:42750481-42750503 CCTTACCAGGCCTTCTTTTCATC No data
Right 1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107671464 Original CRISPR GATGAAAAGAAGGCCTGGTA AGG (reversed) Intergenic
No off target data available for this crispr