ID: 1107671467

View in Genome Browser
Species Human (GRCh38)
Location 13:42750491-42750513
Sequence AACCAAAGCTGATGAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107671467_1107671471 -8 Left 1107671467 13:42750491-42750513 CCTTCTTTTCATCAGCTTTGGTT No data
Right 1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107671467 Original CRISPR AACCAAAGCTGATGAAAAGA AGG (reversed) Intergenic
No off target data available for this crispr