ID: 1107671471

View in Genome Browser
Species Human (GRCh38)
Location 13:42750506-42750528
Sequence CTTTGGTTCTTCAAGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107671465_1107671471 -3 Left 1107671465 13:42750486-42750508 CCAGGCCTTCTTTTCATCAGCTT No data
Right 1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG No data
1107671467_1107671471 -8 Left 1107671467 13:42750491-42750513 CCTTCTTTTCATCAGCTTTGGTT No data
Right 1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG No data
1107671463_1107671471 14 Left 1107671463 13:42750469-42750491 CCAGGGTCTGTACCTTACCAGGC No data
Right 1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG No data
1107671461_1107671471 15 Left 1107671461 13:42750468-42750490 CCCAGGGTCTGTACCTTACCAGG No data
Right 1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG No data
1107671464_1107671471 2 Left 1107671464 13:42750481-42750503 CCTTACCAGGCCTTCTTTTCATC No data
Right 1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG No data
1107671460_1107671471 25 Left 1107671460 13:42750458-42750480 CCTTTTTCTACCCAGGGTCTGTA No data
Right 1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107671471 Original CRISPR CTTTGGTTCTTCAAGTGGGG AGG Intergenic
No off target data available for this crispr