ID: 1107674222

View in Genome Browser
Species Human (GRCh38)
Location 13:42777743-42777765
Sequence GAATACTGCTTGGCTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107674222_1107674229 3 Left 1107674222 13:42777743-42777765 CCTGATTCAGCCAAGCAGTATTC 0: 1
1: 0
2: 2
3: 14
4: 102
Right 1107674229 13:42777769-42777791 GTGGGAACGGAACATACCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 82
1107674222_1107674227 -10 Left 1107674222 13:42777743-42777765 CCTGATTCAGCCAAGCAGTATTC 0: 1
1: 0
2: 2
3: 14
4: 102
Right 1107674227 13:42777756-42777778 AGCAGTATTCCAGGTGGGAACGG 0: 1
1: 0
2: 1
3: 23
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107674222 Original CRISPR GAATACTGCTTGGCTGAATC AGG (reversed) Intergenic
902610175 1:17592552-17592574 CAATACTGCTTTGCTGAGCCTGG - Intronic
906412918 1:45593712-45593734 AAATACTGCTTGGCTGGGTGTGG + Intronic
911656968 1:100454846-100454868 GAGTACAGCTTGGCTGACTCTGG + Intronic
912612524 1:111062595-111062617 GAATTTTTCTGGGCTGAATCTGG - Intergenic
912857943 1:113188390-113188412 GCACACTGCTTGTCTGAGTCTGG - Intergenic
912860687 1:113211253-113211275 GAACACTGCATAGCTGAATGTGG + Intergenic
913181993 1:116331023-116331045 AAATATTTCTTGGCTGAGTCAGG + Intergenic
914449682 1:147779970-147779992 CCAAACTGCTTGGCTGTATCTGG - Intergenic
917453245 1:175164643-175164665 GAATACTCTTTGGCTGTATGGGG - Intronic
917528376 1:175810259-175810281 AACAACAGCTTGGCTGAATCAGG + Intergenic
918055647 1:181019492-181019514 GAAAGCTGCGTGGGTGAATCAGG + Intronic
920724227 1:208418598-208418620 TATTACTTATTGGCTGAATCGGG + Intergenic
921554111 1:216576241-216576263 GGAAACTGCTTGGCTGCATGTGG + Intronic
921664603 1:217853057-217853079 GAATACTGCTTGGCTTAAGTAGG + Intronic
924116058 1:240748379-240748401 GAATAATGCTGGGGTGAACCTGG - Intergenic
924636437 1:245792172-245792194 GAAGAGTGCTTGGCTGATTGTGG - Intronic
1065368451 10:24957171-24957193 GAATACTGGTTAGCAGAGTCAGG - Intergenic
1069351101 10:67528566-67528588 GAATACTGTGTGGCTGAGTTTGG - Intronic
1072221163 10:93328762-93328784 GACTACAGCTTGGATGAATTTGG - Exonic
1078385347 11:10886621-10886643 GAATACTTGTTGATTGAATCGGG + Intergenic
1078522643 11:12075736-12075758 GAAGACTGCTGGGCTGGATTTGG - Intergenic
1085918074 11:80915307-80915329 AAAAACTGCTAAGCTGAATCAGG - Intergenic
1086269985 11:85051218-85051240 CAATACTGCTGGACTGAAACTGG - Intronic
1095237765 12:39818889-39818911 GAATTCTGCTTGGGACAATCAGG - Intronic
1098241773 12:68474592-68474614 GGATCCTGCTTTGCTGCATCCGG + Intergenic
1104742260 12:131186915-131186937 GAATAGTGCTTGCCGGAAGCTGG + Intergenic
1106536422 13:30648153-30648175 ATATACTGCTTGGCTGAAGAGGG - Intronic
1107674222 13:42777743-42777765 GAATACTGCTTGGCTGAATCAGG - Intergenic
1110572736 13:77024425-77024447 GAATACTGATTGCCTGTTTCTGG + Intronic
1111910241 13:94302909-94302931 GACTAGTGCTTAGCTGAATTAGG + Intronic
1112955073 13:105047526-105047548 GAATACTGCCTGGCTCAGTGTGG - Intergenic
1114774535 14:25466227-25466249 GAACACTGTTTGGCTGAAAGAGG + Intergenic
1118573472 14:67218411-67218433 CAAGTCTGCTTGGCTGACTCAGG + Intronic
1122408690 14:101514961-101514983 GAGTGCTGCTGGGCTGACTCTGG - Intergenic
1126314199 15:47351514-47351536 GATTACCTCTTAGCTGAATCAGG - Intronic
1126454035 15:48841780-48841802 GAATCCAGCTTGGTTGAATAGGG + Intronic
1130371601 15:83289144-83289166 AATTACTGCTTGCCTGAATGTGG + Intergenic
1134370593 16:13620484-13620506 GAATGCTGCTTGGCTGGGTTGGG - Intergenic
1135082323 16:19446708-19446730 CATTACTGCTAGGTTGAATCAGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1136711241 16:32238904-32238926 GAATGTTGCTTTGCTGCATCAGG - Intergenic
1136756666 16:32690503-32690525 GAATGCTGCTTTGCTGCATCAGG + Intergenic
1136811444 16:33179872-33179894 GAATGCTGCTTTGCTGCATCAGG - Intergenic
1136817920 16:33289952-33289974 GAATGCTGCTTTGCTGCATCAGG - Intronic
1136824484 16:33346481-33346503 GAATGCTGCTTTGCTGCATCAGG - Intergenic
1136829550 16:33445252-33445274 GAATGCTGCTTTGCTGCATCAGG - Intergenic
1202990022 16_KI270728v1_random:2841-2863 GAATGCTGCTTTGCTGCATCAGG - Intergenic
1203058815 16_KI270728v1_random:950855-950877 GAATGCTGCTTTGCTGCATCAGG + Intergenic
1142960044 17:3547007-3547029 AAATACTGGATGGCTGAACCCGG + Intronic
1144137839 17:12315615-12315637 GAAGGTTGCTGGGCTGAATCTGG - Intergenic
1146773744 17:35593129-35593151 GAATACTCTTGGGCTAAATCTGG + Intronic
1151877641 17:76876294-76876316 GCAAATTGCTTGGCTGAATCAGG + Intronic
1158333176 18:56385190-56385212 GAATAATCCTTGTCTAAATCAGG - Intergenic
1162786131 19:13036134-13036156 GTATCCTGCTTGGCTGCACCTGG + Intronic
1165088523 19:33369142-33369164 TTATACTGCTTTGCTGATTCAGG - Intergenic
925241666 2:2336405-2336427 GAATAGTGCTGGTCTAAATCAGG + Intergenic
926778967 2:16449535-16449557 GGAGGCTGCTTGGCTGAAGCTGG - Intergenic
927547915 2:23971040-23971062 GAATAATGCTTTGCTGTATGAGG - Intronic
928366126 2:30704856-30704878 CAGAACTGCTTGGCTGAATCTGG - Intergenic
928490603 2:31778770-31778792 GTATACTCCTTGGCTGCAGCAGG - Intergenic
929707963 2:44235622-44235644 AAAGACTGCTTAGCTGAATGTGG + Intronic
930296832 2:49564936-49564958 CACTACTGCTTTGCTCAATCTGG - Intergenic
933581247 2:84129423-84129445 GAATTCTGTTTGGCTGAGACAGG - Intergenic
940800594 2:158128637-158128659 GAACCCAGCTTGGCTGACTCAGG + Intronic
940801864 2:158141936-158141958 GAATCCTGGTTGGCTGAATCTGG + Intergenic
941768336 2:169323761-169323783 GATTACTTCTTGGCTAAAACTGG - Intronic
942153441 2:173102596-173102618 AAATAATGCTTGGCAGAATTAGG + Intronic
945910097 2:215639094-215639116 GAATAATGCTAGGTTGAATTTGG + Intergenic
946356280 2:219187534-219187556 GAAGACTTCTTGACTGTATCAGG - Intergenic
948873996 2:240817929-240817951 GGATGATGCTTGGCTGGATCAGG - Intronic
1172478177 20:35254319-35254341 GAATTCTGCTTAGCTGCCTCAGG - Intronic
1182660143 22:31919320-31919342 GAAGACTCCTTCCCTGAATCAGG - Intergenic
1182941972 22:34285458-34285480 GAATACTGCTTGGATCTACCAGG - Intergenic
949238178 3:1836337-1836359 GAATACTATATGGCTTAATCAGG - Intergenic
952817855 3:37461138-37461160 GAACACTACTCAGCTGAATCTGG - Intronic
956538528 3:70307450-70307472 GAATGCTCCTTGGCTTAATGGGG + Intergenic
956586850 3:70874459-70874481 GAACACTGTTTGTCTGAATTTGG + Intergenic
960267496 3:115637230-115637252 GCAAACTACTTGGCAGAATCAGG - Intronic
961910424 3:130310198-130310220 GATTAATGGTTGGCTGATTCAGG - Intergenic
967468912 3:189840413-189840435 TAATACTGTTTGCCTGAATTTGG - Intronic
970325063 4:14915424-14915446 GAATAAGACTGGGCTGAATCTGG - Intergenic
972564233 4:40255869-40255891 AACTAATGCTTGGCAGAATCAGG + Intergenic
974473153 4:62345050-62345072 GAATACTTCCAGGCTTAATCAGG + Intergenic
977862220 4:101976204-101976226 AAATACAGCTTGGCTGTCTCTGG + Intronic
979881540 4:125965302-125965324 GAATGCTCTTAGGCTGAATCTGG + Intergenic
983399037 4:167239702-167239724 GAATTCTACTTGGCTGAGTAAGG + Intergenic
989001714 5:36767650-36767672 GAATACTGCTTCTATTAATCTGG - Intergenic
991932714 5:71769684-71769706 GCATCCTGCTTGGTGGAATCAGG - Intergenic
994027012 5:95096109-95096131 AAATATTGTTTGGCTGAATTTGG - Intronic
994252977 5:97558751-97558773 GAATATTCCTTGGGTGTATCTGG - Intergenic
995596086 5:113749444-113749466 GAATACTGATTGGTTGGGTCAGG + Intergenic
1003025149 6:2548189-2548211 GAATGCTGATTGGCTGGGTCAGG - Intergenic
1003173297 6:3736905-3736927 AAACACTGCTTGGGAGAATCAGG + Intronic
1006331895 6:33397633-33397655 GAAGACTGCTTGGGAGAATCAGG - Intronic
1007794044 6:44333205-44333227 GAATCCTGTTTAGCTGAATAAGG + Intronic
1015044407 6:128760754-128760776 CAAAACTGCTTGGCTGACTTAGG - Intergenic
1015462243 6:133504780-133504802 GAATACTGCTTGGCCTGACCTGG + Intronic
1016034115 6:139368182-139368204 GAATTCAGCTTGGCTAAATCAGG - Intergenic
1016345651 6:143111314-143111336 GAAAACTTCTTTACTGAATCTGG - Intronic
1018369290 6:163152946-163152968 CAATTCTGCTTGGCTGCTTCAGG + Intronic
1023462412 7:40413316-40413338 GAATACTGCTTGGCTGTGTCTGG + Intronic
1024775433 7:52779500-52779522 GAATGCTGATTGGTTGGATCAGG - Intergenic
1025933323 7:66013749-66013771 CACTACTGCTTTGCTGAATAAGG + Intergenic
1039406740 8:37319278-37319300 GAATACTGATTGGTTGGGTCAGG + Intergenic
1041461711 8:58118812-58118834 GAACACTGTTTGCCTGAAACAGG + Intronic
1043789100 8:84440697-84440719 GAATACTGCTTGGCATAAAAAGG - Intronic
1048154169 8:131927211-131927233 GAATAATGCTGGGCTGAGGCTGG + Intronic
1048392864 8:133984743-133984765 GAATAATGCCTGGGTGAATTGGG + Intergenic
1052569672 9:30203435-30203457 GAGTAATGCATGGCTGAAGCAGG - Intergenic
1053028049 9:34747726-34747748 GAAAACTGTTTGGCAGGATCTGG + Intergenic
1053474096 9:38369651-38369673 GAATCCTTCTTGGCTGAATAGGG - Intergenic
1057752017 9:97800476-97800498 GAATAGTGCTTGCCTGAAGTAGG + Intergenic
1185793384 X:2944727-2944749 GAATATTGCTTGAGTGAGTCAGG - Intronic
1192830895 X:74749936-74749958 GAATAATGTTTGGCTGAAATAGG + Intronic
1192959127 X:76108245-76108267 CAATACTGCTTGCCTGGATGGGG + Intergenic
1192986478 X:76405332-76405354 GAATACTTTTGGGCTGAGTCTGG + Intergenic
1195289016 X:103413890-103413912 GCACACTGCTTGGCTGCAACAGG + Intergenic
1198318488 X:135494398-135494420 GAATACTGCTTGGCAGTAGAAGG + Intergenic
1198743834 X:139869169-139869191 GAATACTGCTTCAATGAATATGG - Intronic