ID: 1107676583

View in Genome Browser
Species Human (GRCh38)
Location 13:42804022-42804044
Sequence GTAGAGCAAGTCTTCTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107676583_1107676587 4 Left 1107676583 13:42804022-42804044 CCTTAAAAGAAGACTTGCTCTAC No data
Right 1107676587 13:42804049-42804071 TCTCTCCTCCCTCTTTGGGTTGG No data
1107676583_1107676584 -1 Left 1107676583 13:42804022-42804044 CCTTAAAAGAAGACTTGCTCTAC No data
Right 1107676584 13:42804044-42804066 CTTCCTCTCTCCTCCCTCTTTGG No data
1107676583_1107676592 20 Left 1107676583 13:42804022-42804044 CCTTAAAAGAAGACTTGCTCTAC No data
Right 1107676592 13:42804065-42804087 GGGTTGGAATATGAATGTGGAGG No data
1107676583_1107676594 22 Left 1107676583 13:42804022-42804044 CCTTAAAAGAAGACTTGCTCTAC No data
Right 1107676594 13:42804067-42804089 GTTGGAATATGAATGTGGAGGGG No data
1107676583_1107676593 21 Left 1107676583 13:42804022-42804044 CCTTAAAAGAAGACTTGCTCTAC No data
Right 1107676593 13:42804066-42804088 GGTTGGAATATGAATGTGGAGGG No data
1107676583_1107676591 17 Left 1107676583 13:42804022-42804044 CCTTAAAAGAAGACTTGCTCTAC No data
Right 1107676591 13:42804062-42804084 TTTGGGTTGGAATATGAATGTGG No data
1107676583_1107676585 0 Left 1107676583 13:42804022-42804044 CCTTAAAAGAAGACTTGCTCTAC No data
Right 1107676585 13:42804045-42804067 TTCCTCTCTCCTCCCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107676583 Original CRISPR GTAGAGCAAGTCTTCTTTTA AGG (reversed) Intergenic
No off target data available for this crispr