ID: 1107680282

View in Genome Browser
Species Human (GRCh38)
Location 13:42841314-42841336
Sequence CAGGTAAAAGATGTTGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107680282_1107680289 29 Left 1107680282 13:42841314-42841336 CCTACTGCAACATCTTTTACCTG No data
Right 1107680289 13:42841366-42841388 CCCAGACTAACACAAAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107680282 Original CRISPR CAGGTAAAAGATGTTGCAGT AGG (reversed) Intergenic
No off target data available for this crispr