ID: 1107685123

View in Genome Browser
Species Human (GRCh38)
Location 13:42889473-42889495
Sequence CTCCTTGTTTACTCTGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107685118_1107685123 23 Left 1107685118 13:42889427-42889449 CCACTGCTTCTTTCCATGGCTTG 0: 1
1: 0
2: 6
3: 70
4: 555
Right 1107685123 13:42889473-42889495 CTCCTTGTTTACTCTGTCTCTGG 0: 1
1: 0
2: 3
3: 24
4: 272
1107685120_1107685123 10 Left 1107685120 13:42889440-42889462 CCATGGCTTGGTTTTATCATAAT 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1107685123 13:42889473-42889495 CTCCTTGTTTACTCTGTCTCTGG 0: 1
1: 0
2: 3
3: 24
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107685123 Original CRISPR CTCCTTGTTTACTCTGTCTC TGG Intronic
900433758 1:2616680-2616702 CTCCCTCTTTACCCTTTCTCAGG - Intronic
900908610 1:5578170-5578192 CTCCCTATTTAATCTCTCTCTGG + Intergenic
901208223 1:7509492-7509514 CTCCTGGTTTACTCTATTTCTGG + Intronic
901215539 1:7552830-7552852 CTCCTGGTTCACTGTGACTCTGG - Intronic
903761445 1:25701527-25701549 TTCCCTGTTTCCTCTGCCTCAGG + Intronic
906304673 1:44709371-44709393 GTCCTTGTTTTCCCTATCTCAGG + Intronic
906779500 1:48559894-48559916 CTCATTGTTTACTGTGTGTCAGG - Intronic
908678644 1:66634142-66634164 CCTCTCGTTAACTCTGTCTCAGG + Intronic
910148418 1:84110931-84110953 CTCCTTGTTGACTGAGTCTTAGG + Intronic
911906929 1:103581356-103581378 CTCATTGATTGCTCTGTTTCAGG + Intergenic
915972482 1:160364436-160364458 CACCTTGTTCTCTTTGTCTCTGG + Intergenic
915979594 1:160411454-160411476 CCCCTTATTTAATCAGTCTCAGG - Intronic
918402353 1:184176105-184176127 GTCCTTGTCTACTCTGTCCCTGG - Intergenic
918725736 1:187920619-187920641 CTCCATGTTTACTCTTTCCAAGG + Intergenic
919818695 1:201458871-201458893 CTGCTTTTTTGCTCTGTCCCAGG - Intergenic
921545709 1:216472657-216472679 CTCCTTGTTCATTCTTTCACTGG - Intergenic
922251230 1:223850362-223850384 CTCCTTGTTCACTCTGCCCTGGG - Intergenic
922430674 1:225549361-225549383 ATCCTCTTTCACTCTGTCTCTGG + Intronic
923637244 1:235711199-235711221 CTCCTTGTTTTCTCTGTCCATGG - Intronic
924093371 1:240525277-240525299 CTCCTTGCTTACCTTCTCTCTGG + Intronic
924698380 1:246423870-246423892 CTCCTGGTTTGCACTGTTTCTGG - Intronic
1063578031 10:7279301-7279323 CTTCTTGTTACCTTTGTCTCTGG - Intronic
1063665231 10:8056651-8056673 CTCTTGCCTTACTCTGTCTCTGG + Intronic
1064451302 10:15444596-15444618 CTCCGTGCTTCCTCTGTCACTGG + Intergenic
1067899459 10:50223802-50223824 CACCTTGTTCTCTATGTCTCTGG - Intronic
1068994677 10:63189683-63189705 CTACTTGTATTCTCTGTCCCAGG - Intronic
1069098377 10:64287867-64287889 CATCTTGCTTACTCTGTCTAGGG + Intergenic
1069229148 10:65986128-65986150 CTTTTTGTTTATTTTGTCTCTGG + Intronic
1069639413 10:69945197-69945219 CACCTTGCTGGCTCTGTCTCAGG + Intronic
1069727355 10:70589318-70589340 CTGCTTGTTGAGTCTGCCTCTGG + Intergenic
1070574211 10:77665272-77665294 CACCCTGTTTCCTCTGTCCCTGG - Intergenic
1072524258 10:96257530-96257552 CTGCTGATTTACTTTGTCTCAGG - Intronic
1072844474 10:98814599-98814621 TTGATTGTTTTCTCTGTCTCTGG - Intronic
1075020519 10:118948773-118948795 CCCCTTGTCTTCTCTGTCTTTGG - Intergenic
1075462701 10:122628950-122628972 CTCTTTGTTTACTTTTTCTAAGG - Intronic
1077775461 11:5266859-5266881 ATCCCTGTTTACTCTGTTTATGG + Intronic
1079678449 11:23262477-23262499 CTCCATGTGTGCTCTTTCTCTGG - Intergenic
1081167716 11:39826420-39826442 CTCCTTGTTTACTCTGCTAAAGG - Intergenic
1081375587 11:42354307-42354329 CTCCATATTTTCTATGTCTCTGG + Intergenic
1081515942 11:43829736-43829758 CTCCTTCCTTATTCTGTTTCTGG + Intronic
1082079164 11:47998802-47998824 CTACTTGAATAATCTGTCTCAGG + Intronic
1083006689 11:59353478-59353500 TTCCTTGTTTATTTTTTCTCTGG + Intergenic
1083278274 11:61609735-61609757 CTCCTTCTATCATCTGTCTCTGG - Intergenic
1086037768 11:82437458-82437480 CTCCTTGTTATCTCTCCCTCTGG - Intergenic
1087179053 11:95124137-95124159 CTCCTTTTTTTCTCTCTCTTGGG - Intronic
1089891863 11:121889511-121889533 CACCTGGTTCTCTCTGTCTCAGG - Intergenic
1089956899 11:122579801-122579823 GTCCTTTTTTTCTCTCTCTCAGG + Intergenic
1090265933 11:125352931-125352953 CTCCTTCTGAACTTTGTCTCGGG - Intronic
1091366488 11:135025219-135025241 CTCATTGTTTTCTCTGGCTGTGG - Intergenic
1091693749 12:2614193-2614215 CTCCTAATTTCCTCTGTCCCTGG + Intronic
1094249196 12:28340316-28340338 CTCCTTGTTTATTCAGTCTTTGG + Intronic
1094708535 12:32938296-32938318 CTCCATGTTTACTGGGGCTCCGG + Intergenic
1095100487 12:38177024-38177046 TTACATGTTTACTCTGTGTCTGG + Intergenic
1095422019 12:42034028-42034050 TTTATTGTTTACTATGTCTCAGG + Intergenic
1095877343 12:47095915-47095937 GTTTTTTTTTACTCTGTCTCAGG + Intronic
1097689164 12:62718130-62718152 CTGCCTGTTTACTATGTGTCAGG + Intronic
1097911702 12:64977083-64977105 CTCATTGTTTAATCTTTCTGTGG + Intergenic
1098289383 12:68942572-68942594 TTTATTGTTTACTCTGTGTCAGG + Intronic
1099713229 12:86256238-86256260 CGAATTGTTTTCTCTGTCTCTGG - Intronic
1102010111 12:109612982-109613004 CTGCTGGTGTACTCTGTCCCTGG + Intergenic
1103294936 12:119877769-119877791 TACCTTGATTACTCTATCTCCGG + Intergenic
1105983924 13:25547201-25547223 CTCCTGGGTTACACTGACTCTGG - Intronic
1107248953 13:38333804-38333826 CTCAATGATTACTCTCTCTCAGG + Intergenic
1107364812 13:39658697-39658719 CTCATTGTTTGCTCTGTCTGTGG + Intronic
1107685123 13:42889473-42889495 CTCCTTGTTTACTCTGTCTCTGG + Intronic
1108455454 13:50609260-50609282 CTGCTTCTCTGCTCTGTCTCAGG + Intronic
1108518718 13:51225532-51225554 CTCCAAGTCTACTCTTTCTCAGG - Intronic
1109320395 13:60803425-60803447 ATCCTTGTTAACTCTCTGTCTGG + Intergenic
1114678730 14:24464585-24464607 CTCATTTTTTACTCAGTCTTTGG - Intergenic
1114913213 14:27227091-27227113 CCCCTTGTTTTCTCTGTTTTAGG + Intergenic
1115803610 14:37025129-37025151 CTACTTGTTTATTCTGGCTACGG - Intronic
1117388308 14:55238842-55238864 CTCCTTATTTACTTTTTATCTGG + Intergenic
1118348180 14:64954945-64954967 CTCCTTGTCAGTTCTGTCTCTGG - Intronic
1118839358 14:69499590-69499612 CTCCTTCTTCCCTTTGTCTCGGG - Intronic
1119580517 14:75774995-75775017 CTCCTGGTTTTCTGTGTTTCTGG + Intronic
1120432480 14:84436692-84436714 CTCCTTGTTTTATCTGGCACTGG + Intergenic
1120667451 14:87323583-87323605 CTCATTGTTTTCTCTCTCTCTGG - Intergenic
1121554157 14:94823662-94823684 GTCCTTGTAAACTCTGTATCTGG + Intergenic
1122166146 14:99825546-99825568 CTCCTTGTCTTCTCTGTCCCAGG + Intronic
1122182824 14:99968264-99968286 CTCCTTCTCTACACTGTTTCGGG - Intergenic
1122452705 14:101823599-101823621 ATACTTGTTTACTCTCTCACAGG - Intronic
1124890017 15:33724246-33724268 CTCATTTCTTCCTCTGTCTCTGG + Intronic
1126397743 15:48236983-48237005 CTCCTTGTTTCCTCAGTGCCTGG - Intronic
1127814871 15:62599049-62599071 CTCCTTGTCACCTCTGTGTCAGG + Intronic
1127837009 15:62798050-62798072 CTCTTTCTTAACTCTGTCTCTGG - Intronic
1128303514 15:66582265-66582287 CTCCTTTTCTTCTCAGTCTCGGG + Intronic
1128379044 15:67098297-67098319 CTTCTTTTTTAATCTGTCTTGGG - Intronic
1129684841 15:77679738-77679760 GTCCTTGTAAACTCTGTATCTGG + Intronic
1131827523 15:96332740-96332762 TTCCTTCTTTACTCTCTCTTTGG + Intronic
1131989932 15:98083284-98083306 CTCCTTGTGTAGCCTGCCTCTGG - Intergenic
1132998490 16:2836757-2836779 CTCTTTGTCTTCTCTTTCTCTGG - Intronic
1133909158 16:10049271-10049293 CTCTGTGTTTACTCTATCTCAGG + Intronic
1137692396 16:50438074-50438096 CTTCTTGTTTGCTTTGTATCTGG - Intergenic
1141437870 16:84010968-84010990 CTCCTTGTCTACCCCATCTCTGG - Intronic
1143277735 17:5724791-5724813 CCCCTTGTTTGCACTGTTTCTGG - Intergenic
1143937629 17:10503649-10503671 CCCTTTGTCTACTCTGTCACTGG - Intronic
1144460944 17:15458193-15458215 CACCCTGTTTCCTCTGGCTCTGG + Intronic
1144505877 17:15830413-15830435 CTCATTGTTTACTTTGACTTGGG + Intergenic
1144932958 17:18874859-18874881 CTCCTTGGTTTCTGTGTCTGTGG + Intronic
1145170051 17:20648345-20648367 CTCATTGTTTACTTTGACTTGGG + Intergenic
1146549389 17:33767142-33767164 CTGCTTGTCTGCTGTGTCTCTGG + Intronic
1147027325 17:37598567-37598589 CTCTTTCTCTCCTCTGTCTCCGG + Intronic
1148438397 17:47699246-47699268 CTCCTGTTTCACTCTGGCTCTGG + Intronic
1149647883 17:58253579-58253601 CTCCTGGTCCTCTCTGTCTCCGG + Intronic
1151257690 17:72891614-72891636 CTCCCTGGTCACTCTCTCTCCGG + Intronic
1153552012 18:6272125-6272147 CTTCTTTTTTCCTCTCTCTCTGG - Intronic
1154050759 18:10954736-10954758 CTCCTGGTCTCCCCTGTCTCTGG - Intronic
1154385172 18:13886697-13886719 CTTCTTATTTTCTGTGTCTCTGG + Intronic
1155162112 18:23204650-23204672 TTCTTTTTTTACTCAGTCTCAGG - Intronic
1157083851 18:44556766-44556788 CCCCTTGTTTGCTGTCTCTCTGG - Intergenic
1157315511 18:46585738-46585760 CTCCTTGATTATTCATTCTCAGG - Intronic
1157765496 18:50293736-50293758 GACCTTGGTTACTCAGTCTCCGG - Intergenic
1157935491 18:51867513-51867535 CTCCTTGCTTTCTTTGTCTCAGG + Intergenic
1158039966 18:53081125-53081147 CTCTTTATTTCCTCTGTCTGTGG + Intronic
1159009981 18:63049935-63049957 CTCCTTGCTTGCTTTCTCTCTGG + Intergenic
1159100184 18:63949545-63949567 GTCCTTCTTTACTCGGTCTCTGG + Intronic
1159901605 18:74052672-74052694 CTCCTGGTTTAGGCTCTCTCAGG + Intergenic
1159997004 18:74974877-74974899 CTCCTTCTTTGCTGTGTCTTTGG + Intronic
1161771019 19:6230713-6230735 TTTCTTGTTTTCTCTGTTTCAGG - Exonic
1164427740 19:28157459-28157481 CTCTTTGTTCACTTTCTCTCAGG - Intergenic
1164732210 19:30514797-30514819 CTCATTGTTGACTCCGGCTCTGG + Intronic
1167894644 19:52571013-52571035 ATTCTTCTTTTCTCTGTCTCAGG - Intronic
1167904582 19:52648234-52648256 ATTCTTCTTTTCTCTGTCTCAGG + Intronic
1167909365 19:52689715-52689737 ATTCTTCTTTTCTCTGTCTCAGG + Intronic
1167913874 19:52725001-52725023 ATTCTTCTTTTCTCTGTCTCTGG + Intronic
1167919698 19:52772810-52772832 CTCCTTGTATTTTCTGTGTCTGG - Intronic
1167921380 19:52786005-52786027 ATTCTTCTTTTCTCTGTCTCTGG + Intronic
1167925884 19:52820860-52820882 ATTCTTCTTTTCTCTGTCTCAGG + Intronic
1167930071 19:52856846-52856868 ATTCTTCTTTTCTCTGTCTCAGG + Intronic
1167934205 19:52893081-52893103 ATTCTTCTTTTCTCTGTCTCAGG + Intronic
1167937884 19:52922644-52922666 CTTCTTCTTTTATCTGTCTCAGG + Intergenic
1167940385 19:52941918-52941940 ATTCTTCTTTTCTCTGTCTCAGG + Intronic
1167987978 19:53334394-53334416 ATTCTTCTTTTCTCTGTCTCAGG - Intronic
1167991790 19:53366450-53366472 ATTCTTCTTTTCTCTGTCTCAGG - Intronic
1168687926 19:58359387-58359409 TTCCATTTTTACTCAGTCTCAGG - Intronic
925006465 2:446740-446762 GTCCTTGTCTCCTCTCTCTCAGG - Intergenic
925013924 2:507594-507616 CTCCTTCTGTTCTCTGTTTCTGG - Intergenic
925073600 2:991151-991173 CATCTGGTTTTCTCTGTCTCTGG - Intronic
925230776 2:2232074-2232096 CTCATTGTGTTCTCTGTCGCAGG - Intronic
925508600 2:4598763-4598785 CTCGTTCTTGACTCTGGCTCTGG - Intergenic
927607846 2:24504322-24504344 CTCCTTGGTTACTGTGGCTTTGG + Intronic
928373220 2:30756241-30756263 CTCCCAGTTTCCTCTGCCTCAGG + Intronic
932756295 2:74412305-74412327 CTTCTTGCTTTCTCTGTTTCTGG + Intergenic
933776998 2:85777097-85777119 CTGAGTGTTTACTCTGTGTCAGG + Intronic
934676331 2:96252462-96252484 CACCTTGTTTGCTCTGGGTCTGG - Exonic
935057794 2:99582498-99582520 CTCCTAATTTACTTTGTCCCGGG + Intronic
935188238 2:100753673-100753695 CTCCTTCTGTGCTCAGTCTCAGG - Intergenic
936443344 2:112575371-112575393 CTGGTTGGTGACTCTGTCTCGGG - Exonic
937106803 2:119323430-119323452 CTCCTCTTTTACTCTGTTCCTGG - Intronic
941607201 2:167613090-167613112 CTCCCTTTTTCCTCTCTCTCAGG - Intergenic
941661695 2:168201992-168202014 CTCGTTGTTTTCTGTTTCTCTGG - Intronic
942447909 2:176090715-176090737 CTTCATGTTTTCTCTGTCTGAGG + Intergenic
942495591 2:176536668-176536690 CTCCTTTTATACTCTGTCACTGG + Intergenic
942608389 2:177715792-177715814 CTCCTTCTTTTCTCTGTGTTTGG + Intronic
942623669 2:177876057-177876079 CTCCTCTTCTACTCTGTCTTGGG - Intronic
943562234 2:189477691-189477713 TTCCTTGTTTTCTTTGTTTCTGG + Intergenic
944345325 2:198658303-198658325 CTACTGGTTTACTCTGTTCCAGG - Intergenic
948260676 2:236602182-236602204 CTCCTTGTTTAGGCTGGCTGTGG - Intergenic
948751648 2:240136559-240136581 CTCCTTCTTTATTCTGGATCCGG - Intronic
1169291444 20:4356661-4356683 TCCTTTATTTACTCTGTCTCAGG + Intergenic
1170018571 20:11810630-11810652 CTCCTTTTTTCCTTTGTCACTGG + Intergenic
1171906433 20:30903304-30903326 TTCCTTGTTTTCTCTGTCTCTGG + Intergenic
1172194011 20:33079715-33079737 CACCTTGTCTACTCAGTGTCCGG + Intronic
1172624888 20:36341288-36341310 CCCCTGGTTTTCTCTGTCCCAGG + Intronic
1173140967 20:40482463-40482485 CTCTTTTTTTATTCTGTCACTGG + Intergenic
1178058689 21:28828250-28828272 CTCCTTACTTACTGTGTCACGGG - Intergenic
1180923797 22:19538196-19538218 CTACTTGCTTGCTCTGTCACAGG - Intergenic
1183009292 22:34931696-34931718 CTCATTCTTCACTCTGTCCCTGG - Intergenic
1203326311 22_KI270738v1_random:24519-24541 CTGGTTGTTTACTATTTCTCTGG - Intergenic
950112618 3:10429141-10429163 CTCCGGGTCTCCTCTGTCTCCGG + Intronic
950363310 3:12465097-12465119 CTCTGTGATTTCTCTGTCTCTGG + Intergenic
951249461 3:20377898-20377920 CTCCATGCAAACTCTGTCTCCGG - Intergenic
951539146 3:23765780-23765802 CTCCTTATTTCCTCTGCCCCGGG - Intergenic
952077019 3:29709158-29709180 CTCCCTCTAAACTCTGTCTCAGG + Intronic
952081281 3:29760418-29760440 CTCCCTGTTCAATCTCTCTCTGG - Intronic
952604383 3:35126657-35126679 CCTCTTGTTTTCTCTGTCTAGGG - Intergenic
952937767 3:38413541-38413563 CTCCTTGTTTCAGCTGTCTGAGG + Exonic
954557763 3:51531734-51531756 CTCCATGTTTACACTTTCTAGGG + Intergenic
955385301 3:58474557-58474579 CTGATTGTTTACTCTGTTCCTGG - Intergenic
956799864 3:72747457-72747479 CACCTTGTTTTCTGTCTCTCAGG - Intergenic
958992666 3:100865216-100865238 GTGCTTGTTTACTCTATCCCAGG - Intronic
962446943 3:135474298-135474320 ATCCTTGTTTACTATATGTCAGG + Intergenic
962655141 3:137536103-137536125 CTCCTTGTTAACTATGTCAAAGG + Intergenic
963339611 3:144019132-144019154 CTCCTTTTCTTCTCAGTCTCCGG - Intronic
967087684 3:186109226-186109248 CCTCTTGTTTACCCTGTCTGCGG + Intronic
967768594 3:193309618-193309640 CGTCTTGTGTGCTCTGTCTCTGG + Intronic
970073842 4:12195423-12195445 CTGCTTTCCTACTCTGTCTCAGG - Intergenic
970960950 4:21870682-21870704 TTCTTTGTTTACTCTGACTTTGG + Intronic
971441521 4:26692725-26692747 CTCCTAGTTATCTCTGTCTCTGG - Intronic
974212794 4:58803357-58803379 CTCCTTTTTTCCCCAGTCTCAGG - Intergenic
974450020 4:62042476-62042498 CTGGTTGTTTTCTCTGTCTGGGG - Intronic
974664347 4:64938318-64938340 CTCCCTCCTTACTCTGTCTCTGG + Intergenic
975603471 4:76127701-76127723 CTCTTTGTTAATTCTGTCTTTGG - Intronic
975706497 4:77117325-77117347 CTCTTTTTTTTCTCAGTCTCAGG - Intergenic
976891329 4:90051082-90051104 GTCCTTGATTACTCTGTCTGTGG + Intergenic
978251632 4:106637985-106638007 CACCTAGTTTATTCTGTATCTGG + Intergenic
978264344 4:106804576-106804598 CTCCTTATTTACTCTTCCTATGG + Intergenic
978760215 4:112349347-112349369 CTCCTAGTTTACTCTGGATTTGG - Intronic
982495555 4:156087394-156087416 CTAGTTGCTTTCTCTGTCTCAGG + Intergenic
982899805 4:160983565-160983587 CTCCTAACTTACTCTGACTCAGG - Intergenic
986738735 5:10687206-10687228 CTCCTTGTATACTTGGTCTTGGG - Intronic
986767160 5:10938647-10938669 CTCCTTCATTACTTTGCCTCTGG - Intergenic
987344343 5:16965709-16965731 CTTTTTGTTTTCTCTGTCTAGGG - Intergenic
987848376 5:23317571-23317593 CTGCTTTCTTTCTCTGTCTCTGG - Intergenic
988254662 5:28806830-28806852 CTCCATATTATCTCTGTCTCTGG - Intergenic
988510909 5:31864046-31864068 CTCCTTGCTTTTTCTGTTTCTGG + Intronic
988634304 5:32966022-32966044 CTCCTTGATCTCTCTCTCTCTGG - Intergenic
991227830 5:64293030-64293052 CACCCTGTCTACTCTGTCTCAGG + Intronic
991745595 5:69737501-69737523 CTCAGTGTTTCCTCTGTCTTTGG - Intergenic
991752111 5:69817732-69817754 CTCAGTGTTTCCTCTGTCTTTGG + Intergenic
991797162 5:70317254-70317276 CTCAGTGTTTCCTCTGTCTTTGG - Intergenic
991824973 5:70612815-70612837 CTCAGTGTTTCCTCTGTCTTTGG - Intergenic
991831431 5:70692837-70692859 CTCAGTGTTTCCTCTGTCTTTGG + Intergenic
991889541 5:71316787-71316809 CTCAGTGTTTCCTCTGTCTTTGG - Intergenic
993280856 5:85922576-85922598 CTTCTTGTGTACTATTTCTCAGG - Intergenic
994296326 5:98092889-98092911 CTCTTTATTTTCTCTCTCTCTGG - Intergenic
995006339 5:107200429-107200451 GTCCTTGTTCACTCTTTCTCAGG - Intergenic
996117039 5:119630761-119630783 CTCTTTATTTGCTCTTTCTCTGG + Intronic
996682343 5:126241486-126241508 CTCCTTGATTACTTATTCTCAGG - Intergenic
997647004 5:135488423-135488445 GTCCTTGTTTATTCTGTGGCTGG - Intergenic
997823505 5:137086472-137086494 CTCTTTGTTTACTCTGAGTGTGG + Intronic
998770519 5:145539083-145539105 CTCCTTGTTTCGGCTGTCTTAGG - Intronic
1000716832 5:164654194-164654216 CTCCTTGATTACTTCTTCTCAGG + Intergenic
1002026212 5:176397629-176397651 CTACTTGTTCACTCTGGCGCTGG + Exonic
1003247820 6:4399209-4399231 CTCCTTCTTTCCTCTGCCACAGG - Intergenic
1004476899 6:15981690-15981712 TTCCTTGTGTCCTCTGGCTCTGG + Intergenic
1006019756 6:31111193-31111215 CTCCTTGGTTTCTTTGTTTCTGG - Intergenic
1006344983 6:33473710-33473732 CTCCTTGTATACTTTGAGTCAGG + Intergenic
1007210014 6:40185844-40185866 CTCCATGTACACTCTTTCTCTGG - Intergenic
1007387218 6:41528121-41528143 CTTCTTGTTTGTTCTGGCTCTGG - Intergenic
1010555209 6:77270883-77270905 CTTCTTGTTTTCTCCGTCTAAGG + Intergenic
1010572785 6:77498087-77498109 TTCTTTTTTTAATCTGTCTCCGG - Intergenic
1010676316 6:78748586-78748608 CTCTTTTTTTTCTCAGTCTCAGG + Intergenic
1012271762 6:97221491-97221513 CACCTTATTTACTCTTTATCAGG - Intronic
1012585697 6:100919434-100919456 CCCCTTGTTTACTATGACACTGG + Intergenic
1014794783 6:125712508-125712530 CTCCTTGTTTCCTTTGTCTTGGG + Intergenic
1015315870 6:131815457-131815479 CTCCATGTTGTCTCTTTCTCAGG + Intronic
1019322149 7:420675-420697 CTCCTGGGTTCCTCTGTGTCGGG - Intergenic
1019460736 7:1157070-1157092 GCCCGTGTTTACTTTGTCTCTGG - Intronic
1019923073 7:4174989-4175011 CTGCTTCTTCACTCTGTCCCCGG - Intronic
1022620990 7:31984484-31984506 CTCCTTGTTTTCTCTTTCCCTGG + Intronic
1022744418 7:33155681-33155703 CTTTGTGTCTACTCTGTCTCAGG + Exonic
1025008042 7:55370243-55370265 CTCTTTGATCACTCAGTCTCAGG - Intronic
1026242540 7:68589477-68589499 CTTCTTCTTTACTCAGTCTCAGG - Intergenic
1027477939 7:78656659-78656681 CTCCTTGCTTACTTTTTCTCTGG - Intronic
1028658502 7:93238431-93238453 TTTGTTGTTTACTCTGTTTCTGG + Intronic
1031594794 7:123637579-123637601 CTCCCTGGACACTCTGTCTCTGG + Exonic
1032158072 7:129486476-129486498 TTCCTTGTGTACTCTGTATAGGG + Exonic
1032877299 7:136051295-136051317 CTCATTGTGCAGTCTGTCTCTGG + Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1033865146 7:145681480-145681502 CTCTCTGTTTTCTCTGTCTGTGG + Intergenic
1035714768 8:1745516-1745538 TTGCTTGTTTACTTTGTTTCTGG - Intergenic
1035749916 8:1989970-1989992 CTCCTCTCTTCCTCTGTCTCTGG - Intronic
1037185591 8:16058702-16058724 CTCTTTTCTTACTCAGTCTCAGG - Intergenic
1037259772 8:16995352-16995374 CTCCCTTTTATCTCTGTCTCTGG + Intronic
1039567810 8:38563952-38563974 CTCCTGGTTTACCCTGTGTTAGG + Intergenic
1039799741 8:40943951-40943973 ATCCCTGTTTCCGCTGTCTCTGG - Intergenic
1040639874 8:49320875-49320897 GTCTTTGTTTACACTGTTTCTGG + Intergenic
1040949196 8:52919150-52919172 TTCCTGGTTTACTCTGTCTTAGG - Intergenic
1041379258 8:57236078-57236100 TTCCTTGTTTACTCTTTATTCGG + Intergenic
1041789149 8:61672354-61672376 TACCTTTTTTTCTCTGTCTCTGG - Intronic
1042283765 8:67083912-67083934 CTCATTTCTTCCTCTGTCTCAGG + Intronic
1043620332 8:82182744-82182766 CTCCTAAATTACTCAGTCTCAGG + Intergenic
1045746308 8:105426369-105426391 CTCCTTGTTTTCTCTGGATTTGG + Intronic
1046844999 8:118905747-118905769 CTCCTTGCTTCCTCTGTCTCTGG + Intergenic
1049168162 8:141139863-141139885 CTCCTTCTTCACTATGTATCCGG + Intronic
1049356396 8:142191002-142191024 CTCTCTGTTCTCTCTGTCTCTGG + Intergenic
1050227877 9:3481895-3481917 TTCTTTGTTTACTCTGACACTGG - Intronic
1050717145 9:8542746-8542768 CTCCTTATCTGCTTTGTCTCAGG + Intronic
1051248212 9:15133555-15133577 CCTCTTGTTTACCCTCTCTCAGG - Intergenic
1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG + Intronic
1054936780 9:70696567-70696589 TTCTTTCTTTACCCTGTCTCAGG - Intronic
1054971753 9:71095892-71095914 CTCCATGTCCACTCTGTCTCTGG - Intronic
1055003826 9:71483516-71483538 CTTCTTGTTTTCTCTGTCCTGGG + Intergenic
1055139548 9:72860187-72860209 CTCCTGGTTTTCACTGTCGCTGG + Intergenic
1055856872 9:80698946-80698968 CTCATTGTTTATTTAGTCTCTGG + Intergenic
1056481922 9:87014474-87014496 CTTTTTGTTTTCTCTGTGTCAGG + Intergenic
1056801957 9:89698591-89698613 CTCCTTCTCTCCTCTGTGTCCGG + Intergenic
1057357589 9:94344660-94344682 CTACTTGTTTATTTTCTCTCTGG + Intergenic
1057616349 9:96594149-96594171 CTTTTTGTTTCCTGTGTCTCAGG - Intronic
1057616366 9:96594296-96594318 CTCTTTGGTTACTCTGTCCTGGG - Intronic
1057650164 9:96912965-96912987 CTACTTGTTTATTTTCTCTCTGG - Intronic
1058891354 9:109364023-109364045 CTGCTTTTTTATTCTGTTTCTGG + Intergenic
1059606022 9:115837232-115837254 CACCTTGTTTCCTGTCTCTCAGG - Intergenic
1060115071 9:120933954-120933976 CTCCTTGATTTTTCTCTCTCAGG - Intergenic
1060695793 9:125707710-125707732 CTGCATGTTTACTATGTGTCAGG - Intergenic
1062573000 9:137194155-137194177 CTCCTTGTTTTGTCTGGCCCAGG - Intronic
1185593443 X:1293539-1293561 CTCTTTGTCTACTCTGTGTAGGG - Intronic
1186485136 X:9928448-9928470 TGCCTTGCTTACTCTATCTCTGG + Intronic
1188228587 X:27632492-27632514 CTCCTTGTTCACTCTGTCCCAGG + Intronic
1188287046 X:28340024-28340046 CTCTTTGTTTGCTGTGTTTCTGG + Intergenic
1189559223 X:42175470-42175492 CTCCTTCATTACTGTATCTCTGG + Intergenic
1189786078 X:44559919-44559941 CTCCGTGTTTTCTCAGCCTCTGG + Intergenic
1192055169 X:67766475-67766497 ATCCTTGCTCACTCTGCCTCAGG + Intergenic
1193977145 X:88135177-88135199 CTCCTTCCTTATTCTTTCTCTGG - Intergenic
1194141374 X:90214208-90214230 CTCTTTCTTTTCTCAGTCTCTGG + Intergenic
1195146734 X:102026134-102026156 CCCATTGTAAACTCTGTCTCTGG - Intergenic
1196278181 X:113793029-113793051 CTACTTGTTTGCTCCATCTCTGG - Intergenic
1199552472 X:149074588-149074610 CTGCTTGGTTACTCTGCCTTTGG + Intergenic
1200109283 X:153731902-153731924 CTCCTTTTATACTGTGTATCAGG + Intronic