ID: 1107687666

View in Genome Browser
Species Human (GRCh38)
Location 13:42920282-42920304
Sequence TAGGGTAATTTTGGGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107687666 Original CRISPR TAGGGTAATTTTGGGGAGAA TGG (reversed) Intronic
900997981 1:6133142-6133164 TAGGCTCATTTTGGGCAGGAGGG + Intronic
901411960 1:9090467-9090489 TAGGATTATTGTGGGAAGAATGG - Intergenic
904240669 1:29142654-29142676 GTGGATAATTATGGGGAGAAGGG + Intergenic
904459124 1:30664983-30665005 CAAGGTCATCTTGGGGAGAAGGG + Intergenic
905014274 1:34766495-34766517 TAGAGTCATTTTGGGGAGTAGGG - Intronic
905517108 1:38569955-38569977 GAGGGTACTGTTGGGGTGAAAGG - Intergenic
907282063 1:53355453-53355475 ATAGGTCATTTTGGGGAGAATGG + Intergenic
909415076 1:75397204-75397226 TATGGTAATTTTGGGGAATGGGG + Intronic
909961356 1:81847687-81847709 GAGGGAAATATTAGGGAGAAAGG - Intronic
910733842 1:90429586-90429608 CAGGGATATTTTGGGGATAATGG - Intergenic
911032131 1:93500437-93500459 TATTGTACCTTTGGGGAGAAAGG + Intronic
911475096 1:98364488-98364510 TAGGGAGATTTTTGGAAGAAAGG + Intergenic
911833091 1:102579344-102579366 TAGGATATTTTTGGAGAAAAGGG + Intergenic
913195889 1:116455503-116455525 TGGGTTAATTTTGGTGGGAATGG - Intergenic
917315486 1:173720408-173720430 TAGGGTATTTTGAGGAAGAAGGG + Intronic
917766444 1:178223749-178223771 TAGATTCATTTAGGGGAGAATGG + Intronic
919992296 1:202716671-202716693 TAGGGTAGGTTTGGGGAGGAGGG + Intergenic
921282649 1:213582618-213582640 AAGGTTAGTTTTGGGGTGAAAGG + Intergenic
923312549 1:232749016-232749038 AAGGGTAATTTTGGCAGGAAGGG - Intergenic
923950269 1:238943814-238943836 TAGTGTCATTTTGCTGAGAAAGG + Intergenic
1063571782 10:7221882-7221904 AAGGGTATTTTGGGGGTGAAGGG - Intronic
1065357265 10:24854644-24854666 TAGGCTTATTATGGGGAGAAGGG + Intronic
1065543622 10:26796146-26796168 CATGGTTATTTTGGGGGGAAAGG + Intronic
1067759073 10:49029771-49029793 AAGGGGAAGTTGGGGGAGAAGGG + Intronic
1068026976 10:51658348-51658370 TATGGTAATCCTGGAGAGAAAGG - Intronic
1068740381 10:60462533-60462555 TAGAGAAATTTAGGGGAAAAAGG - Intronic
1068794500 10:61063882-61063904 TAGGGATATTTGGGGCAGAAAGG - Intergenic
1069227539 10:65962505-65962527 TAGGGCAATATTGATGAGAATGG - Intronic
1069504022 10:68980565-68980587 TGGGTAAATTTTGGGGTGAAAGG + Intronic
1070175622 10:73966983-73967005 TAAGGTATTTTTGTGGGGAAGGG + Intergenic
1070757879 10:79004866-79004888 TAGGTTTCTTTTAGGGAGAAGGG - Intergenic
1071274795 10:84043628-84043650 TAGGGAAAGTGTGGGGTGAAAGG - Intergenic
1072893050 10:99342053-99342075 AAGAGTGATTTTGTGGAGAACGG - Intronic
1073773774 10:106763832-106763854 TAGAGTAATTTTAGATAGAAAGG - Intronic
1074237094 10:111596303-111596325 TGATGTAATTTTGGGAAGAAAGG - Intergenic
1076087373 10:127646261-127646283 CAAGGCAATTTTGGGGGGAAAGG + Intergenic
1076349743 10:129807835-129807857 TAGGGTCATTTTGAGGAACAAGG + Intergenic
1078944373 11:16047047-16047069 TGGGGAAATTATGGGGAGGAAGG + Intronic
1079622790 11:22574619-22574641 GAGGGTAATTTTGAGTAGAAAGG + Intergenic
1080535901 11:33221355-33221377 GTGGGTAATTTTGAGGAGGAGGG + Intergenic
1082878920 11:58018863-58018885 TTGGTTAATTTTGAGGAGGAGGG + Intergenic
1083974122 11:66103428-66103450 TGGGGTAATTTAGGAGAAAAGGG + Intronic
1084919943 11:72460999-72461021 GAGGGTAATTTTGTGGATAAGGG - Intergenic
1085389475 11:76175213-76175235 ACCGGTAATGTTGGGGAGAACGG + Intergenic
1086111177 11:83200096-83200118 TTGGGTGATTTTGGAGAGAAGGG + Intronic
1087145286 11:94804632-94804654 TAGGTTAATTTTGTGGGGAAGGG + Intronic
1087290269 11:96313519-96313541 TGGGGCAATTTTGGGGAGGCTGG - Intronic
1089577673 11:119458156-119458178 CAGGGGGATTGTGGGGAGAATGG + Intergenic
1089739063 11:120569645-120569667 TAGAGTGACTTTGGGGAGAAGGG + Intronic
1093407348 12:18820659-18820681 TAGACTCATTTTGGGAAGAAAGG - Intergenic
1093865967 12:24227913-24227935 CAGGGCAGTTTTGGGGAAAATGG - Intergenic
1094053714 12:26247246-26247268 TAGGGCAATATTGGGAAGGATGG + Intronic
1097374299 12:58822214-58822236 AAGGGTAGATTTGGGGAGAATGG - Intergenic
1098680525 12:73348159-73348181 TAGGGTAATGGTGGGGAGAGGGG + Intergenic
1099568616 12:84284569-84284591 TAGTGTATATTTGGGGAGCAAGG + Intergenic
1101356212 12:103979714-103979736 GAGCTTAATTTTGGGGAGACAGG + Intronic
1103605422 12:122082301-122082323 TTGGGACATTTTGGAGAGAAGGG + Intronic
1105940792 13:25146217-25146239 TAGGGTAAAGTATGGGAGAAGGG - Intergenic
1107018807 13:35731005-35731027 TAGGGTGAGGTTTGGGAGAAGGG + Intergenic
1107149978 13:37099729-37099751 TAGGGTGATGTGTGGGAGAAGGG + Intergenic
1107687666 13:42920282-42920304 TAGGGTAATTTTGGGGAGAATGG - Intronic
1109588293 13:64440222-64440244 TGAGATAATTTTGTGGAGAATGG + Intergenic
1113897663 13:113776179-113776201 TTGGGTTAATTTTGGGAGAAGGG + Intronic
1114734872 14:25033978-25034000 TAGTGCTATTTTGGGGTGAAGGG - Intronic
1114772577 14:25445015-25445037 TAGGGTAAGGTATGGGAGAAAGG - Intergenic
1114848393 14:26351960-26351982 CAGGATAATTATGGGGTGAAAGG + Intergenic
1115425779 14:33257399-33257421 TAGGGTAAGTCCAGGGAGAAAGG - Intronic
1116537786 14:46057273-46057295 TAGGGAGATTTTGAGGAGAATGG + Intergenic
1120122879 14:80703012-80703034 TATGGTAAATTTGGAGAGAATGG + Intronic
1120564774 14:86042221-86042243 TATTGTAATTTTTGGAAGAATGG - Intergenic
1120682741 14:87500076-87500098 TATGTTTATTTTGGTGAGAAAGG - Intergenic
1120784420 14:88518901-88518923 TAATGAAATTTTGGGGACAAAGG - Intronic
1122430901 14:101642561-101642583 CAGGGTTCTTTTGGAGAGAAGGG + Intergenic
1122526392 14:102388335-102388357 TCAGGTAAATTTAGGGAGAATGG - Intronic
1123178798 14:106447501-106447523 CAGGGTGATAGTGGGGAGAAGGG + Intergenic
1124029525 15:25997232-25997254 AAGGGCAATTTGGTGGAGAAAGG - Intergenic
1125077437 15:35635630-35635652 CAGTGTAATTATGGGGATAAAGG + Intergenic
1125407164 15:39364664-39364686 TGGGGTAGTTTTGGATAGAAAGG - Intergenic
1125555882 15:40584237-40584259 TAGTGTAATTATGGGGTCAATGG + Intergenic
1126684903 15:51240075-51240097 AAGGGTCATTCTGCGGAGAAGGG - Intronic
1129062528 15:72871757-72871779 GAGGGTATTTTTGGCTAGAAAGG + Intergenic
1129787313 15:78318334-78318356 TAGAGTATTTTGGGGGTGAATGG + Intergenic
1129919011 15:79302571-79302593 TAGGGTAATTCTTGGGAGAAGGG + Intergenic
1129971510 15:79781423-79781445 TAGGGTAATTTGGAGGAAAGAGG - Intergenic
1130199155 15:81809119-81809141 TAGGGCATTTTTAGGGAGAGAGG + Intergenic
1131383059 15:91980464-91980486 TAGGGTGATAGAGGGGAGAAGGG + Intronic
1131503528 15:92994804-92994826 AAGGGAGACTTTGGGGAGAAGGG - Intronic
1131703929 15:94972256-94972278 TTGGGTCAGTTTGGGCAGAATGG - Intergenic
1132345719 15:101107593-101107615 TATGGTCATGATGGGGAGAAAGG - Intergenic
1133639998 16:7707617-7707639 TGGGGCAATTTTCTGGAGAAGGG - Intronic
1133994095 16:10734383-10734405 AAAGTTAATTTTGTGGAGAAAGG + Intergenic
1135174398 16:20215257-20215279 CAGGGTAGTTCTGGGGAGGAGGG + Intergenic
1137715884 16:50598087-50598109 TAGAGCTATTTTGGGGACAAGGG + Intronic
1138979463 16:62249494-62249516 TACGGTAACTTTTGGAAGAACGG + Intergenic
1142781220 17:2182673-2182695 GAGGGCACTTTTGGGGAGTAGGG - Intronic
1143295524 17:5868888-5868910 TTGAGTTATTGTGGGGAGAATGG + Intronic
1146623812 17:34420883-34420905 TAGAGTGAGTTTGGGGAGGAGGG - Intergenic
1147613247 17:41813413-41813435 GAGGGTATCTTTGGGGAGATGGG - Intronic
1149152120 17:53579327-53579349 TAATGTAATTTTAGGGAAAAAGG + Intergenic
1149410805 17:56404704-56404726 TAGTGTGATTTTGGGGGGTATGG + Intronic
1149646582 17:58245699-58245721 TAGTTTAATTCTAGGGAGAAAGG - Intronic
1150282880 17:63939747-63939769 TAGGATCACTTTGGGGAGAGAGG + Exonic
1153387496 18:4514525-4514547 TGGGGTAAGCTGGGGGAGAAGGG - Intergenic
1155548228 18:26937474-26937496 TAGTATAATTGTGGAGAGAAAGG + Intronic
1155817566 18:30333032-30333054 AAGGGTAATTTTGGAGAGAAAGG + Intergenic
1156866623 18:41895789-41895811 AAGGATAATTTTGTGGACAAGGG - Intergenic
1157721064 18:49924880-49924902 GAGGGCAATTTGTGGGAGAAAGG - Intronic
1158684189 18:59598263-59598285 TGGGGTGATTCTGGGGTGAAGGG - Intronic
1159090271 18:63840449-63840471 TAGGCCATTTTTGGGGTGAAAGG - Intergenic
1159435898 18:68416495-68416517 TAGGGTGATTTTGGGAAGGAGGG - Intergenic
1161359173 19:3836970-3836992 GAGGGTCATTTTGGGGAAAATGG + Intronic
1165712413 19:38021421-38021443 CAGGGTAGTTCTGGGGACAAGGG + Intronic
1167707076 19:51087457-51087479 ATGGGTGATTTTGGAGAGAAAGG + Intergenic
925149860 2:1607519-1607541 GAAGGAAATTTTGGGGAGAGAGG + Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
926779094 2:16451062-16451084 TATTGTAATTTAGAGGAGAAGGG + Intergenic
927060524 2:19414573-19414595 TAGGCCAATTTTTGGAAGAATGG - Intergenic
927793731 2:26031066-26031088 TACGTAAATTTTGGGGATAATGG - Intergenic
928980382 2:37130427-37130449 TAGGAGTATTGTGGGGAGAATGG - Intronic
929306877 2:40373464-40373486 TGGGGTCATTTTAGGGGGAAGGG - Intronic
929640621 2:43575476-43575498 TAGGGAAATTTGGGGGATGATGG + Intronic
929761012 2:44806153-44806175 TGGTGGAATTTTGGGGAGCATGG + Intergenic
930099498 2:47591937-47591959 TAGGAAGATTTTGGGGAAAAAGG - Intergenic
930431099 2:51277573-51277595 TAGGGTAATTTTTAGGAGTTTGG - Intergenic
931066887 2:58597713-58597735 TAGGGGAAGTATTGGGAGAATGG + Intergenic
932594692 2:73086723-73086745 TAGGGGAAGATTGGGAAGAAGGG - Intronic
933352972 2:81178709-81178731 CAGGGAAATACTGGGGAGAAGGG - Intergenic
935591157 2:104846216-104846238 TACCGAAATTTTGGGGAGAGAGG + Intergenic
936264391 2:110990994-110991016 TAGAGTTATTTTGGGGGGAGTGG + Intronic
936712922 2:115153643-115153665 AAGGGTTATTTTGGGAAGATAGG - Intronic
937507885 2:122557435-122557457 TAGGGTAATGATGAGGATAAAGG + Intergenic
939033965 2:137109255-137109277 TTGGACAATTTTGGGAAGAATGG - Intronic
939160898 2:138587588-138587610 AAGGAAAATTTTGGAGAGAAAGG - Intergenic
939627761 2:144498969-144498991 TACGGACATTTTCGGGAGAAAGG - Intronic
940435120 2:153643560-153643582 TATGGAAATTTTGTGGAGATTGG - Intergenic
940568706 2:155403314-155403336 TGGGGCATGTTTGGGGAGAAAGG + Intergenic
940769060 2:157821090-157821112 AAGGGTATTTGTGGGGAGATGGG - Intronic
940912257 2:159218963-159218985 AATGGTAATTTGGGGGAGGAGGG - Intronic
941772024 2:169355421-169355443 GGGGGTAATTATTGGGAGAATGG - Intronic
943384552 2:187185064-187185086 CAGGGAAATTCTGGGCAGAAAGG - Intergenic
944150394 2:196552412-196552434 TGTGGAAATTTTGAGGAGAATGG - Intronic
944400452 2:199320023-199320045 TTGGGTAAAATTGGGAAGAAAGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945927232 2:215818059-215818081 TAGGGGAGTCATGGGGAGAAGGG + Intergenic
946192287 2:218013916-218013938 CAGGGCAAACTTGGGGAGAAGGG - Intergenic
946854187 2:223936553-223936575 TAGGGTAATTATGGGCAGGTGGG + Intronic
947478263 2:230471866-230471888 TAGGGGAATTTTGTGGGGGAGGG + Intronic
948207406 2:236169408-236169430 TAAGGGAATTTTGGGGTGGAGGG + Intergenic
948474800 2:238210462-238210484 TAGGAGTATTGTGGGGAGAATGG + Intergenic
948960457 2:241331384-241331406 TGGGACAATTTGGGGGAGAAAGG - Intronic
1168736088 20:138141-138163 TGTGGTAATGATGGGGAGAATGG - Intergenic
1168767684 20:392880-392902 AAAGATAATTCTGGGGAGAAGGG + Intronic
1168824791 20:802817-802839 GAGATTAATTTTGGGGGGAAAGG - Intergenic
1170498942 20:16954809-16954831 GAAGGTGGTTTTGGGGAGAAGGG - Intergenic
1171956055 20:31464679-31464701 TGGGGAAATTTTGGGAGGAAGGG - Intergenic
1172126963 20:32630221-32630243 TGGGGCAATTTCAGGGAGAAGGG - Intergenic
1172311958 20:33925417-33925439 TAAGGTTATTTTGGAGAGATGGG - Intergenic
1177235667 21:18386493-18386515 TTGGATATTTTTGGGGAGAAGGG + Intronic
1177299679 21:19226637-19226659 TGGCTTGATTTTGGGGAGAATGG + Intergenic
1177322793 21:19544306-19544328 TAGGGTAAGGTATGGGAGAAAGG - Intergenic
1177946109 21:27471497-27471519 AAGGGTATTTTTGGGGGGAGTGG + Intergenic
1179003661 21:37488572-37488594 TAACCAAATTTTGGGGAGAATGG - Intronic
949777016 3:7645093-7645115 AAGGCTCATTTTGGGGAAAATGG - Intronic
950653745 3:14423964-14423986 CAGGATGATTCTGGGGAGAAGGG + Intronic
952063591 3:29540935-29540957 TAAGGCAATTTAGGGGAGTAGGG - Intronic
952217563 3:31292901-31292923 AAGTGTAATTTTGGAAAGAAAGG - Intergenic
952600150 3:35070349-35070371 CAGGGTAATTCTGGTGAAAAAGG - Intergenic
956690381 3:71872955-71872977 TAGGGTAATTAGGGAGATAATGG - Intergenic
957550438 3:81697267-81697289 TAGGGTAAGGTATGGGAGAAAGG + Intronic
957869529 3:86072355-86072377 TATGATTATTTTGGAGAGAATGG + Intronic
957885147 3:86278228-86278250 ATGGCTTATTTTGGGGAGAATGG - Intergenic
958158968 3:89791557-89791579 TGGGGTAATTTGGGGTAAAATGG + Intergenic
959219662 3:103500627-103500649 TGGGGTATTTTGGGAGAGAAGGG + Intergenic
961159745 3:124713677-124713699 TGGGGTAGTGGTGGGGAGAAAGG - Intronic
962012379 3:131404623-131404645 TAGGGAAAGGCTGGGGAGAAAGG - Intergenic
962709346 3:138072464-138072486 TAGGGTTATTTTAGGAAGAATGG - Intronic
963735083 3:149009965-149009987 TAGGGTTATTGTGGGTAGTAAGG + Intronic
965158917 3:165105045-165105067 TAAGGAAATTTTGGGGTGATAGG + Intergenic
967807048 3:193724157-193724179 AAGGGCAATTTAGTGGAGAAAGG + Intergenic
968720302 4:2197725-2197747 TAGGTAACTTTTGGGGAGAAGGG - Intronic
970221205 4:13813256-13813278 TAAGGGAATATTGGGGAGAAAGG + Intergenic
970620488 4:17812154-17812176 TAGGGTGATGTTGGGAATAAAGG + Intronic
972728057 4:41763777-41763799 TAGGGTAGTTTAGAGGAGAGTGG + Intergenic
972888086 4:43517878-43517900 TGGGGTAATATTTGGGAGGAGGG - Intergenic
973818275 4:54639223-54639245 AAAAGTAATTTTGGGGAAAAAGG + Intergenic
975167611 4:71195437-71195459 TAGGGTGATTTAGTGGAAAATGG + Intronic
975259362 4:72278144-72278166 TGGGATACTTTTGGGCAGAAGGG + Intergenic
977005029 4:91556664-91556686 TAGGGTAGTTGTGGGATGAATGG + Intronic
977672842 4:99716009-99716031 CAGGGAAATTTTGGGCAGAAGGG + Intergenic
977955588 4:103021881-103021903 TGGGGTAATATTAGGGAGTAAGG - Intronic
978105519 4:104897551-104897573 TATAGTAAGTTTGGGGTGAAAGG - Intergenic
979097597 4:116570841-116570863 TAGGGTAATATGAGAGAGAAAGG + Intergenic
979105598 4:116682577-116682599 TAGGGTTTTTTTTGGGGGAAGGG + Intergenic
980673714 4:136046516-136046538 TACAAAAATTTTGGGGAGAACGG + Intergenic
980744551 4:136998553-136998575 TGGGATCATTTGGGGGAGAAGGG + Intergenic
980884001 4:138742435-138742457 CAGGGAAATTTTAGGAAGAAAGG + Intergenic
981001130 4:139830258-139830280 TAGAGAATCTTTGGGGAGAAAGG - Intronic
981247424 4:142556490-142556512 TTGGGTAGTTTTGGGAATAAAGG + Intronic
981373450 4:143987022-143987044 CAAGGAAATATTGGGGAGAAGGG + Intergenic
986153438 5:5149232-5149254 AAGGGTAATTTTTGGAAAAAGGG + Intronic
989222101 5:38978109-38978131 CAGGGTGTTTTTGGAGAGAAAGG - Intronic
989748797 5:44865743-44865765 TAGGAAAAATTGGGGGAGAAAGG + Intergenic
990973540 5:61536623-61536645 CAGGGTAACTTTGGGGACACTGG - Intronic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
992861188 5:80911893-80911915 AAAGGTAATTTTTAGGAGAAAGG + Intergenic
993774021 5:91968655-91968677 AAGGGCAATTCTGTGGAGAAGGG + Intergenic
994049643 5:95348033-95348055 TAGGGTAAACATTGGGAGAATGG + Intergenic
994766572 5:103925458-103925480 TAGAGTAACTTAGTGGAGAATGG + Intergenic
994897902 5:105728767-105728789 AAGGGTAATTTAGTGGAGAATGG + Intergenic
995793963 5:115922787-115922809 TAGGGTAATTTTGGGAAGCTTGG + Intergenic
996633480 5:125664651-125664673 TAGGAGTATTGTGGGGAGAATGG + Intergenic
996851882 5:127962231-127962253 TATGGTAACTTTGGGGATTAGGG + Intergenic
998189002 5:140006420-140006442 AAGTGGAATTTTGGGGTGAAAGG - Intronic
1001059929 5:168479463-168479485 GAGGGGATTTTTAGGGAGAATGG + Intergenic
1002550224 5:179983401-179983423 AAAGGTAATTCTGTGGAGAATGG - Intronic
1003896537 6:10613458-10613480 GAGGGTAGTTATGGGGAGTATGG - Intronic
1005910858 6:30308266-30308288 TAGGGTATATGTGGGGACAAAGG + Intergenic
1006797498 6:36741117-36741139 TAGGGTATGTTTGGGGTGATGGG + Exonic
1007870454 6:45030701-45030723 TAGAATAATTATGGGGAGTAAGG + Intronic
1008380871 6:50838602-50838624 TAGGGGAAGATTGGGGAGGAGGG + Intronic
1008492671 6:52102571-52102593 GAGGGTAATTCTTGGGAGGAGGG - Intergenic
1009461446 6:63919102-63919124 TAAGTAAATTTTGGGGAGAAAGG + Intronic
1010030978 6:71270429-71270451 TAGGGTAATTTTGGTGATGCTGG + Intergenic
1010922582 6:81702843-81702865 TTGGGTCATTTTGGGGAAAATGG - Intronic
1011227419 6:85122963-85122985 TAAGTTAAGTTTGGAGAGAATGG - Intergenic
1013139010 6:107312243-107312265 AAGGGTATTTCTGGGGAGGATGG - Intronic
1013899001 6:115129779-115129801 CAGGTTTATTTTGAGGAGAAGGG - Intergenic
1014021785 6:116599250-116599272 TAGGTAAATTTTAGGCAGAATGG - Intergenic
1014775410 6:125503417-125503439 GAAGGTGATTTGGGGGAGAAGGG + Intergenic
1014791572 6:125678370-125678392 TAGGATTATTTTGAGGATAAAGG - Intergenic
1017998969 6:159561266-159561288 TAGGGAAATTCTAGGCAGAAGGG - Intergenic
1018649676 6:165982481-165982503 TAGGGTGACATTGGGGAGAGGGG + Intronic
1019302715 7:316205-316227 TTGGGTTATTTTAGGTAGAAGGG + Intergenic
1021058908 7:16085298-16085320 CAGGAAAATTTTGGGGTGAATGG - Intergenic
1022341323 7:29471093-29471115 TAGGGTTATTCTTGAGAGAATGG - Intronic
1026398191 7:69980427-69980449 TAGGATAGTTGTGTGGAGAAAGG + Intronic
1026577840 7:71588889-71588911 TAGGGTAATTTGGGGGAGGGAGG - Intronic
1027629257 7:80581744-80581766 TACAGTTATTTTGAGGAGAATGG + Intronic
1031621968 7:123945292-123945314 GAGGTTAATTTTGGGAGGAAAGG + Intronic
1032374659 7:131399759-131399781 CAGTGTAGTTTTGAGGAGAAGGG + Intronic
1032418593 7:131758992-131759014 TAGGGAAATTTTAGGCACAATGG + Intergenic
1034513572 7:151555421-151555443 AATGGTAATATTTGGGAGAAAGG - Intergenic
1034755152 7:153609943-153609965 TTTGGTAATTTGGTGGAGAAAGG + Intergenic
1034854172 7:154524960-154524982 CTGGCTCATTTTGGGGAGAATGG + Intronic
1035130080 7:156643351-156643373 TATGCTTATTTTGGGGAGAAAGG - Intronic
1035797757 8:2375075-2375097 AAGAGTAAATTAGGGGAGAAAGG + Intergenic
1036769146 8:11566828-11566850 TAGGGTCACCTTGGGTAGAATGG + Intergenic
1036959599 8:13229434-13229456 GGGGGTAGTTTTGGGGAAAATGG + Intronic
1037040350 8:14223363-14223385 TAAGTTAATTTTAGAGAGAACGG + Intronic
1038382009 8:27105171-27105193 TAACACAATTTTGGGGAGAAAGG - Intergenic
1038573816 8:28686704-28686726 TAGGGCAATTAGGAGGAGAAAGG + Intronic
1038746613 8:30260449-30260471 TGGTGTAATTCTGGGGAGCAGGG - Intergenic
1041134573 8:54743754-54743776 TAGTTTAATTTAGTGGAGAATGG + Intergenic
1041460819 8:58109560-58109582 TATGGAAATTCTGGGGAGGAAGG + Intronic
1042823251 8:72954969-72954991 TTGGGTAATGTTGGGGAGCTGGG - Intergenic
1044204815 8:89480917-89480939 TAGGGTAACTTTGGAGAGTCAGG - Intergenic
1046128810 8:109942691-109942713 GAGGGCTATTTTGGTGAGAAAGG - Intergenic
1046718634 8:117594692-117594714 TAGGGCAATTTTCAAGAGAAAGG - Intergenic
1046843214 8:118884890-118884912 CAGTGTAATTATGGGGGGAAAGG - Intergenic
1046881816 8:119317557-119317579 CAATGTAATTTTGGGGTGAAGGG - Intergenic
1047871651 8:129089579-129089601 TAAGTTAATTTTTGGTAGAAAGG + Intergenic
1049934552 9:488833-488855 TATTGTAATTTTAGGGATAATGG + Intronic
1051826702 9:21230105-21230127 TAGGATTATTTGGGGGAGAGAGG - Intronic
1052022275 9:23538989-23539011 TTCTATAATTTTGGGGAGAAAGG - Intergenic
1053283169 9:36834792-36834814 CATGGTGATTTTGGGGACAAGGG + Exonic
1056510283 9:87298133-87298155 TAGGGGAATTTAGGGCAGAGGGG + Intergenic
1056517610 9:87370405-87370427 TTGGTTTATTTTGGGAAGAAAGG + Intergenic
1057210969 9:93200855-93200877 TAGGGTTAGCTTGGGGAAAAGGG + Intronic
1057974117 9:99585877-99585899 TGGGTTACTTTTGGGGAGCAAGG + Intergenic
1058007159 9:99929530-99929552 TAGGTAAATTTCAGGGAGAAAGG - Intronic
1058341109 9:103897773-103897795 GAGGGTAATGTTGGGAATAAGGG - Intergenic
1058394251 9:104531815-104531837 TGGGGTATTATTGGGAAGAAAGG + Intergenic
1058549970 9:106104150-106104172 TGGGGACATTTTGGGGAGCAAGG + Intergenic
1058850180 9:109004256-109004278 TAGGGTAATGTTTAGGAGTACGG - Intronic
1060081100 9:120646191-120646213 TAGGGTAATATTAGTGAGAATGG - Intronic
1060453515 9:123766371-123766393 TTGGGTAATATGGGGGATAACGG - Intronic
1186406471 X:9308344-9308366 TAGGCTAATTGTGGGGAAAAAGG + Intergenic
1186677856 X:11838584-11838606 AAGGGAAATTTTGGGGGTAATGG - Intergenic
1187853966 X:23618891-23618913 TAGGGGAATGTAGGAGAGAAGGG - Intergenic
1188276352 X:28206194-28206216 AAGGGCAATTTTCTGGAGAAAGG + Intergenic
1188277769 X:28222159-28222181 AAGAATAATTTTGGGCAGAATGG - Intergenic
1190186666 X:48240644-48240666 AAGGCAAATTTTGGGGAAAATGG - Intronic
1190903823 X:54706178-54706200 AAGGGTAATTGTGGGGTGATGGG - Intergenic
1191105459 X:56769409-56769431 TTGAGTATTTTGGGGGAGAAGGG + Intergenic
1191106452 X:56774811-56774833 TTGAGTATTTTGGGGGAGAAGGG + Intergenic
1191107445 X:56780213-56780235 TTGAGTATTTTGGGGGAGAAGGG + Intergenic
1192573521 X:72224974-72224996 TAGGAGTATTATGGGGAGAATGG - Intronic
1192612651 X:72583112-72583134 TAAAGTTATTTTGGGGTGAAGGG + Intronic
1194177917 X:90674384-90674406 TAGGGTGAATTTGGCTAGAAAGG + Intergenic
1194547542 X:95256758-95256780 TAGGGTAATTTTGGGGGGGGGGG + Intergenic
1194883865 X:99288354-99288376 TGTGGTTACTTTGGGGAGAAGGG + Intergenic
1195865016 X:109423109-109423131 AAGTGAAATTTTGGAGAGAAGGG + Intronic
1196604111 X:117636200-117636222 TAGGGTAATAGTATGGAGAAAGG - Intergenic
1196678262 X:118443540-118443562 TGGCTGAATTTTGGGGAGAAAGG - Exonic
1198556863 X:137803834-137803856 TAGGTTAATTTTGGGAGAAATGG + Intergenic
1198836968 X:140815861-140815883 TAGGGTAATGTTCTGGAGGAAGG + Intergenic
1200125318 X:153810878-153810900 TATGAAAATTTTGGGGAGAAGGG - Intronic
1200524584 Y:4256541-4256563 TAGGGTGAATTTGGCTAGAAAGG + Intergenic