ID: 1107688641

View in Genome Browser
Species Human (GRCh38)
Location 13:42929526-42929548
Sequence CAAAGGAAAATGCATACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 2, 1: 2, 2: 0, 3: 32, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107688641_1107688643 15 Left 1107688641 13:42929526-42929548 CCTATGGTATGCATTTTCCTTTG 0: 2
1: 2
2: 0
3: 32
4: 254
Right 1107688643 13:42929564-42929586 AACCCAACTTGTTCAACTACAGG 0: 5
1: 17
2: 38
3: 44
4: 106
1107688641_1107688646 26 Left 1107688641 13:42929526-42929548 CCTATGGTATGCATTTTCCTTTG 0: 2
1: 2
2: 0
3: 32
4: 254
Right 1107688646 13:42929575-42929597 TTCAACTACAGGTATATTCCTGG 0: 1
1: 1
2: 20
3: 50
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107688641 Original CRISPR CAAAGGAAAATGCATACCAT AGG (reversed) Intronic
902660918 1:17902989-17903011 GAAAGGAAAATGAGAACCATAGG + Intergenic
903444389 1:23412136-23412158 CAAAGGAGAAGGCATAGAATGGG + Intronic
906526909 1:46499000-46499022 CACACGAACATGCATACCAGAGG + Intergenic
906758812 1:48351720-48351742 CAAAGAAAAATGTAGACCAATGG - Intronic
908707334 1:66972954-66972976 CAAATGAAAATCCTTTCCATAGG - Exonic
913351328 1:117863481-117863503 TAAAGGAATATTCAGACCATTGG - Exonic
913377506 1:118169586-118169608 AAAAGGAAAATGCATTTTATTGG - Intronic
916787803 1:168098855-168098877 CAAGGGAAAAAGCATGCCTTTGG + Intronic
918610720 1:186487564-186487586 CAAAAGAAAATACTTACCTTGGG + Intergenic
918735391 1:188055723-188055745 AAAGGGATAATGCACACCATAGG + Intergenic
918777582 1:188654558-188654580 CATAGGAAAATGTATATCACTGG + Intergenic
918786896 1:188774964-188774986 CATAGGAAAATGTGTGCCATGGG - Intergenic
919513153 1:198491285-198491307 CAAAGGAAAATGAGAACAATAGG + Intergenic
919668672 1:200318506-200318528 CAGAGGAATATGAATATCATGGG - Intergenic
921094879 1:211877830-211877852 AAAAAGAAAATGAATACAATGGG + Intergenic
921233207 1:213095139-213095161 CTAAGGAGAATACATACCATTGG - Intronic
1063776338 10:9269266-9269288 CAAAGGTAAATGCATGTCATAGG - Intergenic
1063928359 10:11003317-11003339 CAAAGGTAAATTCTTAACATTGG - Intergenic
1064246941 10:13675847-13675869 CAAAAGAAAATGCATAGCAATGG - Intronic
1065336866 10:24661370-24661392 CAAAGCAAAATGCAAACACTGGG + Intronic
1066610939 10:37247964-37247986 CAAAGGTAAATTCATGTCATGGG - Intronic
1067542200 10:47163932-47163954 CAAATGGAAAGACATACCATAGG - Intergenic
1067858647 10:49820855-49820877 TAAAGGAAGCTGCAAACCATGGG + Intronic
1068172020 10:53405966-53405988 CAAAGGGAGATTCATGCCATGGG + Intergenic
1068271392 10:54730488-54730510 CAAGGTAAATTGCATGCCATGGG - Intronic
1069197087 10:65564804-65564826 CAAAGGCAAATGCATAGTTTTGG + Intergenic
1069763115 10:70829442-70829464 AAAAGGAAAATGTTTATCATTGG + Intronic
1070780951 10:79137341-79137363 CAAAGGAAAATGGGTACCTCAGG + Intronic
1071410649 10:85389828-85389850 CATAGGTAAATGCGTGCCATGGG - Intergenic
1071719925 10:88132656-88132678 CAAAGGTTAATGCATCCCTTTGG - Intergenic
1073248369 10:102107203-102107225 GTAAGGAATATACATACCATGGG + Intergenic
1073686343 10:105758605-105758627 GAAAGGAAAATGCAGACTAAAGG - Intergenic
1073823570 10:107292759-107292781 CAAAGAAAAATGCATTTCAAAGG + Intergenic
1073974887 10:109089361-109089383 CAAAGGAAACTAAATATCATAGG - Intergenic
1077784515 11:5367914-5367936 GATAGGAAAATGCATAGCCTTGG - Intronic
1077944481 11:6880362-6880384 CAAAAGAAAAGGCAGATCATGGG + Intergenic
1078013214 11:7590089-7590111 CAAAGGCAAATCCTTACCTTAGG + Intronic
1078075620 11:8157472-8157494 CAAGGGAGAATGCACACCATGGG - Intronic
1079347231 11:19663541-19663563 CAATGAAAAGTCCATACCATGGG - Intronic
1079825090 11:25180922-25180944 GAAAGGAAAATGCTTTCCATTGG + Intergenic
1080132216 11:28809895-28809917 CAGAGGAAACTGCATAACAAGGG + Intergenic
1081249240 11:40809349-40809371 CAAAGGAGAATGCAATCCAAAGG - Intronic
1083108764 11:60384422-60384444 CAAATGAAAATCACTACCATTGG - Intronic
1086156334 11:83670505-83670527 CAGAAGAAAATGAATACCTTTGG + Intronic
1088036203 11:105318894-105318916 CATAGAAAAAAGCATATCATTGG - Intergenic
1088644558 11:111907226-111907248 CATAGGTAAATGCATGTCATAGG + Intergenic
1088722087 11:112602103-112602125 CAAAGGAAAATTCAAGCCAGTGG - Intergenic
1090237526 11:125160339-125160361 CAAAGGCAAATGCAAAGCACTGG + Intergenic
1093175524 12:15909590-15909612 CAAGGGAGAATGCTTGCCATGGG + Intergenic
1093963196 12:25298237-25298259 CTAAGCACAATGCCTACCATTGG - Intergenic
1094405012 12:30108149-30108171 AAAAGGAGAGTGCACACCATGGG + Intergenic
1095500255 12:42829887-42829909 CCAAGGAAAAGGCATTCCAGTGG - Intergenic
1099112940 12:78586135-78586157 CAAAAGCCAATGCATAGCATTGG - Intergenic
1101004437 12:100387928-100387950 CAAAGAGAAATGAAAACCATTGG - Intronic
1101085250 12:101229015-101229037 CAAAGGTAAATGGTTATCATAGG - Intergenic
1101136596 12:101750200-101750222 TAAATAAAAATGCTTACCATAGG + Intronic
1101281950 12:103266922-103266944 TAAAGCAAAATGCCTGCCATAGG - Intronic
1101514392 12:105420808-105420830 TAAAGGGAAATGCATAGCAGTGG + Intergenic
1106880127 13:34120132-34120154 CAAAGGAAAAGGGATTGCATAGG + Intergenic
1106988991 13:35393447-35393469 TAAAGAAAAAAGCATACCAAAGG - Intronic
1107688641 13:42929526-42929548 CAAAGGAAAATGCATACCATAGG - Intronic
1108746334 13:53398351-53398373 CAGAGGAAAATGCATCTCATAGG - Intergenic
1109048459 13:57444361-57444383 CAAAAGAACAAGAATACCATCGG - Intergenic
1110817510 13:79878564-79878586 CAAGGTAAAAAGCATGCCATAGG + Intergenic
1111485003 13:88886681-88886703 CAAAGTAAATTGAATACCTTTGG + Intergenic
1111493834 13:89021986-89022008 CAAAGGAGAATGCCTACAAATGG + Intergenic
1114917094 14:27282364-27282386 AAATAAAAAATGCATACCATTGG - Intergenic
1115736791 14:36340932-36340954 GAAGGGACAATGCATACCAAAGG + Intergenic
1115997926 14:39212495-39212517 GGAAGGAAAATGCCAACCATTGG + Intergenic
1116408880 14:44600033-44600055 CAAAGGTAAATGCATTACATTGG + Intergenic
1119015172 14:71043953-71043975 CAAATGACAATCCATACAATTGG - Intronic
1120898427 14:89555274-89555296 CAACTGAAAATGCATATCTTTGG - Intronic
1121222053 14:92293271-92293293 CAAAGGAGAACTCAGACCATGGG - Intergenic
1121955989 14:98213805-98213827 CAAAGGAGAATGTATTCCACCGG + Intergenic
1122345406 14:101055560-101055582 CTCAGGAAAATGCTTGCCATGGG - Intergenic
1125109831 15:36019571-36019593 CAAAGGAAAATGGTTACCGAAGG - Intergenic
1126058805 15:44758500-44758522 CACAGAAAAATGCATACAAATGG - Intronic
1126307469 15:47276848-47276870 CAAAGTAAAATGAAAACCTTCGG + Intronic
1126420937 15:48471201-48471223 CAAAGGCAAACACATGCCATAGG - Intronic
1127497807 15:59529062-59529084 CAAAGGACAGTGAATCCCATGGG - Intergenic
1128016695 15:64354596-64354618 GAAAAAAAAATGCATACAATAGG - Intronic
1129613987 15:77083653-77083675 CAAATGAAAAGGAATACCTTAGG - Intronic
1129896559 15:79112582-79112604 CTCAGGAAAATGCATACAGTTGG - Intergenic
1130094103 15:80843575-80843597 CAAAGCAAAATGGTTAGCATGGG - Intronic
1130637301 15:85636364-85636386 AGAAAGAAAACGCATACCATTGG - Intronic
1131707600 15:95015033-95015055 CAAGGGAATAGGCATAGCATGGG + Intergenic
1134048975 16:11123704-11123726 CAAAGGAAAAGGCATTCGTTGGG - Intronic
1135340449 16:21641654-21641676 CCAAGGAACATGCAAACCACTGG + Intronic
1138004288 16:53316612-53316634 CAAAGGAAAATGCTTTTCCTTGG - Intronic
1138259698 16:55607588-55607610 CAAAGGAAGCTGGATACCAAAGG - Intergenic
1138665580 16:58565014-58565036 ATAAGGCAAATGTATACCATTGG - Intronic
1139871115 16:70109309-70109331 CAAAGGAAAATGAAAGCCAGAGG + Intergenic
1140329776 16:74043283-74043305 AAAAGGAAAATGAATACCACAGG + Intergenic
1140342585 16:74179504-74179526 CATAGGCAAATGCATGTCATGGG - Intergenic
1140375755 16:74444563-74444585 CAAAGGAAAATGAAAGCCAGAGG - Intergenic
1140942627 16:79736198-79736220 CAAAGGAAAAAGCAAACACTGGG + Intergenic
1141011191 16:80401472-80401494 GAAAGAAAAATGCACACCTTTGG - Intergenic
1141798796 16:86293132-86293154 AAATGGAATATGCAAACCATGGG + Intergenic
1142841691 17:2636719-2636741 GAAAAAAAAATGCATACCTTCGG - Intronic
1142905642 17:3039707-3039729 CAAAAGAAAATGCAAATCATGGG - Intergenic
1143230490 17:5350078-5350100 CTAAAGAAATTGCCTACCATTGG + Intronic
1143306911 17:5954578-5954600 CAAAGAGAAATGCATAACAATGG - Intronic
1144170433 17:12654762-12654784 CAAAGGAAAATACACACGAACGG + Intergenic
1145074791 17:19843514-19843536 TAAAGAAAAATACACACCATAGG + Intronic
1146130363 17:30268391-30268413 CAGAGGTAAATGCATACTAGTGG - Intronic
1146341600 17:32023884-32023906 TGAAAGATAATGCATACCATCGG + Intronic
1146351200 17:32095739-32095761 TGAAAGATAATGCATACCATCGG - Intergenic
1146368996 17:32252733-32252755 ATCAGGAAAATCCATACCATAGG - Intronic
1146849836 17:36212391-36212413 CAGAGGAAGATGCCTACCACAGG + Exonic
1147233039 17:39033178-39033200 TAAAAGATAATGCAGACCATCGG + Intergenic
1147292263 17:39453224-39453246 CATAGGAAAATGGGTACAATGGG + Intergenic
1148173728 17:45546645-45546667 TAAAAGATAATGCAGACCATTGG - Intergenic
1148275541 17:46298803-46298825 TAAAAGATAATGCAGACCATTGG + Intronic
1148297647 17:46516371-46516393 TAAAAGATAATGCAGACCATTGG + Intronic
1148362199 17:47020861-47020883 TAAAAGATAATGCAGACCATTGG + Intronic
1149093366 17:52811983-52812005 CACAGGAAAAGAAATACCATTGG + Intergenic
1149329482 17:55566733-55566755 TAAAGGCAAATGCATGTCATAGG + Intergenic
1150404939 17:64893569-64893591 TAAAAGATAATGCAGACCATTGG - Intronic
1150466552 17:65397829-65397851 CAAGGGAAAATGAATAAAATAGG + Intergenic
1150784033 17:68148495-68148517 TAAAAGATAATGCAGACCATTGG - Intergenic
1155479148 18:26266408-26266430 CAAATGAAAATGAATACTATAGG - Intronic
1155777856 18:29791050-29791072 CATAGGTAAATGCATATCACGGG + Intergenic
1156341444 18:36213609-36213631 CAAAGGAAAAGGAATACAAATGG + Intronic
1156745821 18:40389782-40389804 ATAAGTAAAATGCATACCATTGG + Intergenic
1157049054 18:44138814-44138836 CAAAGAAAAATAAAGACCATTGG + Intergenic
1159440200 18:68468910-68468932 CAAAGGAAAAGGGATACAAGTGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1162208009 19:9070428-9070450 CAAAGGGAAATGGATACCCCGGG + Intergenic
1164796182 19:31032740-31032762 AAAAGGAAAATGCAGACAAGTGG + Intergenic
1167687065 19:50963082-50963104 CAATGGAAAATGTAGACCAATGG - Intronic
1167882514 19:52472036-52472058 TAAATGAAAGTGCATGCCATGGG + Intronic
925190666 2:1880749-1880771 CAAAAGAAAACGCAGACCATGGG - Intronic
926020003 2:9486358-9486380 GAAAGGAAACTGCAAACTATTGG + Intronic
927416445 2:22885680-22885702 AAAAGGAAAATGAACAACATGGG - Intergenic
927457476 2:23267552-23267574 CAAAAGAAAAGGCAGGCCATAGG - Intergenic
931103838 2:59032520-59032542 CAAAGAAAAATTCTTACCATGGG - Intergenic
931857045 2:66313838-66313860 CATAGGTAAATGTATGCCATGGG + Intergenic
932136837 2:69238803-69238825 CTAAGGAAAATGGATTCCACAGG - Intronic
932635085 2:73381038-73381060 CAAGGGAGAACGCACACCATGGG + Intergenic
933032649 2:77350967-77350989 CATAGGTAAATGCATGTCATGGG + Intronic
933191984 2:79344356-79344378 GAATGGAAAATGCCAACCATTGG - Intronic
934837965 2:97607067-97607089 CAAAGGAGAATGGCTGCCATTGG - Intergenic
935035355 2:99366595-99366617 CAACAGAAATTGTATACCATGGG - Intronic
935524374 2:104147570-104147592 AAAATCAGAATGCATACCATCGG - Intergenic
939008986 2:136822720-136822742 CAAAGGAAAGTGTATGCCCTGGG - Intronic
939377936 2:141394505-141394527 CAAAGGGAAATGGATGCCCTGGG - Intronic
939416297 2:141902770-141902792 TAAAGGAAAAGGCATAAAATTGG + Intronic
941500921 2:166275151-166275173 CAAAGGGAAAGGCATTCCCTTGG - Intronic
941522153 2:166559431-166559453 GAAAAGAAAATGCATAGCAAAGG + Intergenic
941573918 2:167206323-167206345 CAGAGGAAAATCCATACTACAGG - Intronic
942481261 2:176390938-176390960 CAAAGGAAAATGGATGCCTTTGG + Intergenic
942672705 2:178393405-178393427 AAAAGTAAAATGAATTCCATAGG - Intronic
942887459 2:180944191-180944213 CAAGGGCATGTGCATACCATAGG - Intergenic
943258224 2:185625153-185625175 AAAAGAAAAAAGAATACCATAGG - Intergenic
945010457 2:205456196-205456218 CAATGGTACATCCATACCATGGG - Intronic
945479183 2:210324455-210324477 CAAAGTAAAATGAATGACATTGG + Intergenic
947559131 2:231131113-231131135 CTCAGCAAAATTCATACCATGGG - Intronic
948767172 2:240228517-240228539 CAAAGGCAAAATCATACCACAGG + Intergenic
948987047 2:241532250-241532272 CAAGAGCAACTGCATACCATTGG + Intergenic
1171426464 20:25051674-25051696 CAAAGGAAAAAGAAAACCATTGG - Intronic
1171954043 20:31446099-31446121 CAAAGGAAACTGCACACCAAAGG + Intronic
1173414250 20:42841517-42841539 CATATCAAAATTCATACCATGGG + Intronic
1173969919 20:47144768-47144790 CAATGGAGAATAAATACCATTGG + Intronic
1175090616 20:56500522-56500544 CAAAGGACAATGGCTACCCTTGG - Intronic
1176052560 20:63128002-63128024 CAGTGGAATATGCATTCCATTGG + Intergenic
1176880089 21:14181696-14181718 AAAAGGAAAATGTAGACCTTGGG - Intronic
1177442988 21:21152279-21152301 TAAAGGGAAATGGAAACCATTGG - Intronic
1178738956 21:35178699-35178721 CAATGGCAAATACATACCTTGGG + Intronic
1178955975 21:37022252-37022274 CATAGGTAAATGCATATCATGGG + Intergenic
1178993011 21:37370215-37370237 CAAAACAAAATGCATGCCAAAGG - Intronic
1179262484 21:39770597-39770619 GAAAGAAAAGTGCATGCCATAGG - Intronic
1179409769 21:41153761-41153783 AAGAGGAAAATGAAAACCATAGG + Intergenic
1182588878 22:31363774-31363796 CAAAGGAAAATACAAATCTTCGG - Intergenic
955076080 3:55614563-55614585 CAAAGGAAAATTCATATAATTGG - Intronic
955444494 3:58995002-58995024 CAAAAGAAAATGGATATCCTAGG - Intronic
955788028 3:62560334-62560356 CAGAGGAACATGCATTTCATGGG - Intronic
956712230 3:72048759-72048781 CTAAGGAAATTGCAAAACATCGG + Intergenic
957251178 3:77772827-77772849 CATAGGAGTATGAATACCATTGG - Intergenic
959082185 3:101813515-101813537 TGGAGGAAAATGCAAACCATGGG + Intronic
959282345 3:104360737-104360759 CAAAGGACAATGCACATCATGGG + Intergenic
960048163 3:113216894-113216916 AAAAGGAAAGTGCATAATATGGG + Intronic
962607237 3:137042859-137042881 CATGGGAAATTTCATACCATTGG + Intergenic
963906453 3:150777605-150777627 CAAAAGAAAATGTATGCCAAAGG - Intergenic
963933852 3:151032678-151032700 CACAGGTAAATTCATATCATGGG - Intergenic
964166673 3:153715296-153715318 CAAAGGAGAATGCACACCACGGG + Intergenic
964554619 3:157922660-157922682 CAAAGGTATATGCATACCTTGGG - Intergenic
965056917 3:163731247-163731269 CAAAGGAATATGCAAAATATGGG + Intergenic
966063863 3:175793131-175793153 CCAAGTTAAATTCATACCATGGG + Intronic
966149970 3:176857118-176857140 CAAAGCAAAATAAATACCTTAGG + Intergenic
971938482 4:33185512-33185534 AGAAGGAAAATGCATAAAATAGG - Intergenic
974375872 4:61074881-61074903 CAAAGGAAAATCCAGAGCATGGG - Intergenic
974559746 4:63501951-63501973 ATAAGGAACATGCATACCAAGGG + Intergenic
976138844 4:81968346-81968368 AAAATGAAAATGCAACCCATAGG + Intronic
976879753 4:89905766-89905788 CAAAGAAAATTATATACCATTGG + Intronic
977030104 4:91872808-91872830 CATAGAAAAATTCATAGCATAGG + Intergenic
978194590 4:105956305-105956327 CCAAGCAAAAAGCATAGCATTGG - Intronic
979301608 4:119093427-119093449 CAACAGAAAATGCATTGCATTGG + Intergenic
979417277 4:120459137-120459159 CAATGGAAAATGGAGAGCATAGG + Intergenic
979917671 4:126457313-126457335 CAAAGGAAAATGAAAAGCAAAGG + Intergenic
980799032 4:137724424-137724446 CAAAGGAAAATGCTTAATGTGGG + Intergenic
981859135 4:149333701-149333723 CAAGGAAAACTGCATGCCATGGG + Intergenic
982441130 4:155437315-155437337 TCAAGGAAAAAGAATACCATTGG - Intergenic
983069209 4:163249287-163249309 CAAAGCAATATGCATACCAAGGG - Intergenic
984439407 4:179747316-179747338 CAAAGGAAAGTGCCTGACATAGG + Intergenic
984774515 4:183469229-183469251 AAAAGGAAAAGTCACACCATTGG + Intergenic
986241740 5:5966157-5966179 CAAAGGACATTGCCAACCATAGG + Intergenic
986406571 5:7431627-7431649 AAAATGAAAATGCAAACCACAGG + Intronic
987142070 5:14956831-14956853 CAATTGAAAATGCAAACCGTAGG + Intergenic
988529638 5:32016422-32016444 CAAAGAACAATGAATACCAAGGG + Intronic
989019268 5:36982142-36982164 CTAAAGAAAATGCATACAAAAGG - Intronic
989154596 5:38332331-38332353 CATAGGTAAATACATGCCATGGG + Intronic
990047623 5:51453815-51453837 CAAAGGCAAATCCATTCCACTGG - Intergenic
990516100 5:56532153-56532175 CAAAGGAAAATGTATAAAAAAGG - Intronic
990988691 5:61664065-61664087 CTAAGAAAAATGCAAACTATAGG + Intronic
991561788 5:67961355-67961377 AAAATGAAAATGCATAACAGTGG + Intergenic
991601249 5:68353481-68353503 AAGAGGATAATGCATACCAAAGG + Intergenic
993764389 5:91837633-91837655 CATTGGAAACTGCCTACCATGGG + Intergenic
994111111 5:96005532-96005554 CAGATGAAAATGATTACCATGGG + Intergenic
994545425 5:101161218-101161240 CATAGGTAAATGCATATCATGGG + Intergenic
994901670 5:105780516-105780538 CTAAGAAAAAAGCACACCATGGG - Intergenic
995306948 5:110663313-110663335 TAAAGGATAAGGCATACCTTGGG + Intronic
995333548 5:110973498-110973520 CAAAGGAGAATTCTCACCATTGG - Intergenic
995338267 5:111027503-111027525 CATAGGACAATGAATATCATTGG - Intergenic
995982029 5:118115989-118116011 CAAGGGATATGGCATACCATAGG + Intergenic
996231673 5:121071082-121071104 CATAGGAAAAGGCAAACAATAGG + Intergenic
998228128 5:140342439-140342461 CACAGGAAATTGCATCCTATAGG + Intronic
998875908 5:146599186-146599208 CAAAGGAAAAGGCATTGTATAGG - Intronic
1000728164 5:164798450-164798472 CAAAGCAAAGTGAATTCCATGGG - Intergenic
1001230309 5:169981205-169981227 CAAATGAAAATCCATATCATGGG + Intronic
1001460962 5:171913942-171913964 AAAAGGAAAAGGCAAACCAATGG + Intronic
1001599888 5:172921970-172921992 CAGAGGAATTTGCAGACCATGGG - Intronic
1001860759 5:175052824-175052846 CAAGGGAGAATGTATACCATGGG - Intergenic
1003480992 6:6533133-6533155 CAAAGGAAACTGCACACTAATGG + Intergenic
1005885822 6:30096973-30096995 CAATGGAGAATGCACCCCATGGG - Intergenic
1006751182 6:36378572-36378594 AAAAGGTTAATGCCTACCATAGG + Intronic
1010688210 6:78876987-78877009 CAAAGAATAATGCATCCCAAAGG + Intronic
1011042479 6:83046254-83046276 CAAAGGAAAATGGTTAACATGGG - Intronic
1011758651 6:90533352-90533374 TGAAGGAGAATGCTTACCATGGG + Intronic
1012026445 6:93999064-93999086 CAAATAAAAATGGATATCATGGG + Intergenic
1012122183 6:95383266-95383288 CAAAGGAAAAAGCACATCATAGG + Intergenic
1012322730 6:97870945-97870967 AAAAGTAAAATACTTACCATAGG + Intergenic
1012682924 6:102205759-102205781 TAAAGGAAAATGTGGACCATGGG - Intergenic
1014914428 6:127128782-127128804 CAGAGCAAAATGCACACAATAGG + Intronic
1014978038 6:127913347-127913369 CAAAGGAAAAAGCATGCAAATGG - Intronic
1016705598 6:147103137-147103159 TAAATAAAGATGCATACCATTGG - Intergenic
1016722661 6:147320336-147320358 GAAAAGAAAATGCATCCCCTGGG + Intronic
1016979600 6:149842229-149842251 ACAAGGAAAAGGCATACCACAGG - Intronic
1017757688 6:157543538-157543560 CAAAGGAAAGTCCATAGAATAGG - Intronic
1018311422 6:162513561-162513583 GAAGGAAAAAGGCATACCATGGG + Intronic
1018985978 6:168637582-168637604 CAAAGGAAAACGCAAACATTCGG - Intronic
1021016199 7:15537986-15538008 CAGAGGAAAATGGTTAACATAGG + Intronic
1021794778 7:24243228-24243250 CAAAGGAGAATGCATATCACAGG + Intergenic
1022633516 7:32109005-32109027 CAAAAGAACATGCATAAAATTGG + Intronic
1022766908 7:33423372-33423394 AAAATGAAAATGTATACCTTGGG + Intronic
1027798567 7:82723625-82723647 CAAAGGAAAATGCATACCAGTGG - Intergenic
1031021238 7:116630245-116630267 CCAAGGCAAATGGATACCTTTGG - Intergenic
1032995887 7:137446105-137446127 CAAAGTAAAATTCATGCCAAAGG + Intronic
1034035868 7:147821437-147821459 CACTGGAATATACATACCATGGG - Intronic
1034759055 7:153654017-153654039 GAAAGGAAAATGAAAACAATGGG - Intergenic
1035857160 8:2987941-2987963 CATAGGTAAATGTGTACCATGGG + Intronic
1037151584 8:15641557-15641579 CAAAGGAGTATGCAAACCTTGGG - Intronic
1037505880 8:19528723-19528745 CAAAGGAGAATGCATACCATGGG - Intronic
1038384353 8:27127881-27127903 CAAGGGGAAATGCACCCCATAGG + Intergenic
1041031395 8:53739382-53739404 CAAAGTAATATCCATACCCTTGG + Intronic
1043024828 8:75052901-75052923 GAAAGGAAAATTCTTACCTTTGG - Intergenic
1043116795 8:76265922-76265944 CATAAGAAAATGAATAACATTGG - Intergenic
1043660390 8:82733739-82733761 CAAAGGAAAATGCTTTCCTTTGG - Intergenic
1046555813 8:115771832-115771854 CAAAGGTCTTTGCATACCATGGG - Intronic
1050349419 9:4725631-4725653 GAAAAGACAATGCATAGCATGGG + Intronic
1052016704 9:23477043-23477065 CAAGGAATAATGCATACTATTGG - Intergenic
1052275001 9:26665383-26665405 CAAAGAAAAAGGTATACTATAGG - Intergenic
1053051601 9:34965825-34965847 CAAAAACAAAGGCATACCATTGG + Intronic
1053359800 9:37476766-37476788 AAATGGAAAAAGCATACTATAGG - Intergenic
1058127471 9:101211458-101211480 CAAGGGATGATGCACACCATGGG - Intronic
1058242143 9:102577491-102577513 CATAGAAAAATGAATACCAAAGG - Intergenic
1060009150 9:120028136-120028158 CAAAGGAAAATGCATACCATGGG + Intergenic
1060579661 9:124733586-124733608 CAAAATAAAATGCTTACCATAGG + Intronic
1061812806 9:133172215-133172237 CAAAGGGAAATGCAAATCGTGGG + Intergenic
1186255740 X:7716944-7716966 CAAAGGGAAATGCATGTCTTTGG - Intergenic
1187400706 X:18957431-18957453 CACAGGCAAATGCAGACCACAGG + Intronic
1187975778 X:24703479-24703501 TAAAGGAAAATCCAAACCAAAGG - Intronic
1190229051 X:48567343-48567365 CAATGCAAAATGCATAACAAAGG + Intergenic
1191025656 X:55910095-55910117 CAAAGGAAATTGCAGAGCACCGG - Intergenic
1191627064 X:63280930-63280952 CAACAGAAAATACATACCAAGGG + Intergenic
1194798665 X:98243263-98243285 CAAGGGAGAATGCATACCAGGGG - Intergenic
1195018053 X:100797935-100797957 CAAAAGACAATACATACAATTGG + Intergenic
1198555191 X:137785301-137785323 GAAAGGAAAATGCTTATCTTTGG - Intergenic
1199353533 X:146833410-146833432 CCAAGGAAAATGGAGACCAGAGG - Intergenic
1201331680 Y:12829645-12829667 AAAATGAAAAGGCATAGCATGGG + Intronic
1202018447 Y:20436015-20436037 CAAAGGAAAACCCATAAAATCGG + Intergenic