ID: 1107691713

View in Genome Browser
Species Human (GRCh38)
Location 13:42960120-42960142
Sequence TACAGCCATCCTTTAGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107691713_1107691717 29 Left 1107691713 13:42960120-42960142 CCCATATCTAAAGGATGGCTGTA 0: 1
1: 0
2: 1
3: 15
4: 97
Right 1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107691713 Original CRISPR TACAGCCATCCTTTAGATAT GGG (reversed) Intronic
902936306 1:19767250-19767272 CACAGCCATCCTTTAAATGTAGG - Intronic
908303484 1:62785819-62785841 TTCAGCCATGCTTAAGATTTGGG + Intronic
909155138 1:72064809-72064831 TACAGCAAACCTTGAGATAGAGG + Intronic
910139379 1:84010106-84010128 TACATCCATCTTATAGATAAGGG + Intergenic
920526679 1:206672155-206672177 CACAGTCATCCTTTAGATCCTGG - Intronic
922345335 1:224691591-224691613 GCCAACCATCCTTTAGATGTGGG + Intronic
923839183 1:237649417-237649439 TACAGTTATCCTTTGGTTATTGG + Intronic
1063599690 10:7469137-7469159 TAGTGCCATCCTTAAGATGTCGG + Intergenic
1063778840 10:9297011-9297033 TGCAGACAGCCTTTAGATAATGG - Intergenic
1067826911 10:49582058-49582080 TACAGACATCTTTCTGATATTGG - Intergenic
1068681764 10:59827675-59827697 TAAATCCAACCTTTATATATGGG + Intronic
1069393738 10:67965447-67965469 TATAGCCATTCTATAGATTTAGG - Intronic
1070578129 10:77695985-77696007 TTAAGCCATCCTTAAGAGATTGG - Intergenic
1070622786 10:78026645-78026667 TACTGCTATCCCTTAAATATTGG + Intronic
1072913940 10:99525968-99525990 TGCAGCCATACTTTTGAGATTGG - Intergenic
1081577945 11:44330991-44331013 TACAGTCATTCTTTAGAGATGGG + Intergenic
1083350042 11:62021355-62021377 TACAGAAATCCTTTAGTTAGGGG - Intergenic
1083536132 11:63468251-63468273 TACTGCCATTCTTTAGCAATGGG - Intronic
1085220974 11:74873424-74873446 AAAAGGCATCCTTTAGATCTAGG - Intronic
1089520881 11:119062589-119062611 TGCTGCTATCCTTTAGATACAGG + Intergenic
1090020051 11:123120322-123120344 TACACCCATCTTTCAGATGTTGG + Intronic
1093595089 12:20950039-20950061 AACAGGCATCCTTTAGATCTAGG + Intergenic
1095048290 12:37534149-37534171 TGCAGCTGTCCTTTAGATGTGGG - Intergenic
1101821105 12:108184846-108184868 AACAGCCTTCCTTTACATAAGGG - Intronic
1101891377 12:108718625-108718647 TTCAGACATCCTATAGAAATAGG + Intronic
1103373900 12:120440100-120440122 TACTGCCACCATTTTGATATAGG + Intronic
1107349254 13:39496998-39497020 TACAGCCAGCAGTTAGATCTGGG - Intronic
1107691713 13:42960120-42960142 TACAGCCATCCTTTAGATATGGG - Intronic
1108108593 13:47041829-47041851 TACACCGATGCTTGAGATATTGG + Intergenic
1110031436 13:70619388-70619410 TACAGCTTTTTTTTAGATATGGG - Intergenic
1110702108 13:78561079-78561101 TACAGCCAGTCTTTGGAAATTGG + Intergenic
1112676996 13:101713452-101713474 TACAGCCATCTTTTAGTAAATGG + Exonic
1114743306 14:25120214-25120236 TAAAGCCATCATTTTGACATAGG - Intergenic
1115824344 14:37250184-37250206 TACAGGCATCTTTTTGACATTGG + Intronic
1116290733 14:43035422-43035444 TTCAGATATTCTTTAGATATAGG + Intergenic
1117196650 14:53346376-53346398 TTCAACCTTCCTTTGGATATTGG - Intergenic
1117201896 14:53398911-53398933 TGCAGCCATCATTTATAAATTGG + Intergenic
1118838138 14:69491055-69491077 TTTAGACTTCCTTTAGATATGGG - Intronic
1123881209 15:24678526-24678548 TCCAGCCATCCTTTAAATACAGG + Exonic
1127928609 15:63573563-63573585 TACAGCCATCTGTCAGATTTGGG - Intronic
1128596237 15:68952818-68952840 AACAGCCAACATATAGATATTGG + Intronic
1130690493 15:86077867-86077889 GAGAGCAATCCTTTACATATAGG + Intergenic
1133475923 16:6121815-6121837 CACAGTCATCCTTTAAAGATAGG - Intronic
1134268026 16:12708374-12708396 TACAGCCATTCCTGAGGTATGGG - Intronic
1135944624 16:26855019-26855041 TACAGCCACTTTTTGGATATTGG - Intergenic
1138080413 16:54085325-54085347 TCCAGCCTTCCTTTAGATTTTGG + Intronic
1141026591 16:80554520-80554542 TCCAGCCATCTTTTAGATATAGG - Intergenic
1148027857 17:44600739-44600761 TACATCCTTCCTTTAGGGATGGG - Intergenic
1156002853 18:32405027-32405049 AACAGCTTTCCTTTTGATATTGG - Intronic
1156668184 18:39434067-39434089 TACTGCTATCTTTTTGATATTGG - Intergenic
1162714639 19:12622450-12622472 TTCAGCATTCCTTAAGATATGGG - Intronic
1165791126 19:38493179-38493201 TACCGCCATCCCTTAGTTAGAGG - Intronic
1166427087 19:42688664-42688686 AAAAGCCATCCTTTATATCTAGG + Intronic
925514261 2:4662737-4662759 TACAGACAGCCTTTTGATAACGG - Intergenic
933176053 2:79174295-79174317 TACACCCATCCATTAGCTGTAGG + Intergenic
934063376 2:88317778-88317800 TACAACCATCCTCTAGATGCTGG + Intergenic
940197927 2:151116397-151116419 TACAACCATCCTTTTTAAATGGG - Intergenic
941459544 2:165752534-165752556 TATAGCTATCTTTTAGAAATTGG - Intronic
941835548 2:170014131-170014153 TAAAGCATTCCTTTAGAAATGGG + Intronic
945543800 2:211123601-211123623 TACAGGCAGCCTCTAGAAATTGG - Intergenic
946061856 2:216949505-216949527 TCCAGCAACCCTTTAGACATAGG + Intergenic
946550711 2:220799092-220799114 TACAGCCAAGCATTAGAAATGGG + Intergenic
947304969 2:228735570-228735592 TACAGACAGCCTTTAGAAACTGG + Intergenic
1169163763 20:3405844-3405866 AACAGCCATCCGTTAAATCTAGG - Intronic
1169884195 20:10380211-10380233 TTCAGCCTTCCTTTAAATAGTGG - Intergenic
1171378337 20:24711337-24711359 TATAGCCATCCTATAGGTATAGG + Intergenic
1179633777 21:42694624-42694646 TAATGCCATCCTTTAGATTTTGG + Intronic
1182978737 22:34648034-34648056 TACAGCAATGCTTTAACTATAGG + Intergenic
949312525 3:2715845-2715867 TACTTCCTTACTTTAGATATAGG + Intronic
958212977 3:90515287-90515309 TTCAGCCTTCCTTTTGATAGAGG - Intergenic
958223952 3:90786608-90786630 TTCAGCCTTCCTTTTGATAGAGG + Intergenic
958240552 3:91066097-91066119 TTCAGCCTTCCTTTTGATAGAGG + Intergenic
960520023 3:118643989-118644011 TACAGCCCTGCTTTATATAGAGG + Intergenic
963127887 3:141832180-141832202 TACTGTCATCTTTTAGATATTGG - Intergenic
963455189 3:145537656-145537678 TACAGCCAGCCTCTAGAAATTGG - Intergenic
966062072 3:175769877-175769899 TACAGCCCACCTACAGATATTGG - Intronic
966368816 3:179223729-179223751 TACACCCATTCATTACATATTGG - Intronic
967027330 3:185576314-185576336 CATAGCCATGCTTAAGATATTGG + Intergenic
968051777 3:195659291-195659313 TACAGCCATCCTGTCAACATCGG + Intergenic
968104038 3:195989044-195989066 TACAGCCATCCTGTCAACATCGG - Intergenic
968302340 3:197626633-197626655 TACAGCCATCCTGTCAACATCGG - Intergenic
978371746 4:108036243-108036265 AACATCCTTCCTTTAGACATGGG + Intergenic
981141849 4:141278217-141278239 TACAGACAGCCTTTAGAAACTGG + Intergenic
983335111 4:166381477-166381499 TACTGCCTTCCTTTAGGTTTAGG - Intergenic
984198239 4:176686051-176686073 TACATCCATTCTTTACATATGGG - Intronic
988529134 5:32011928-32011950 TACTGCCATCCTTCAGAAAACGG - Intronic
992622709 5:78609879-78609901 AATAGCCATCCTTTATTTATAGG + Intronic
994068405 5:95569862-95569884 TACTGCCATCTTTTAGATTTTGG - Intronic
1000527987 5:162382403-162382425 TCCAGCCATTATTAAGATATGGG + Intergenic
1002551859 5:180000145-180000167 CAAAGCCATCCTTCAGAAATGGG - Intronic
1007504158 6:42321791-42321813 TACAGCCAACATTTAAAAATTGG - Intronic
1013825948 6:114212019-114212041 CACAGCCATGCTTGAAATATTGG - Intronic
1017273552 6:152538481-152538503 TACAGTCATCATTAAGATATTGG - Intronic
1020523472 7:9226030-9226052 TGCAGTCTTCCTTTAGATAAAGG - Intergenic
1020596174 7:10210707-10210729 TACAGAAATCCTTTACAAATTGG - Intergenic
1029066293 7:97852117-97852139 TACAGCAATGGTTTAGATTTAGG + Exonic
1030304459 7:108004047-108004069 TAAAGCCATCATCTGGATATAGG - Intergenic
1031442686 7:121813042-121813064 TACAGCAATCCCTGAGAGATGGG + Intergenic
1032148720 7:129408770-129408792 TTCAGCCAACCTTTGGATATTGG - Intronic
1032341128 7:131074175-131074197 TCCAGCCATCCTTATGACATAGG + Intergenic
1037373364 8:18203720-18203742 TATAGCCGTCCTTGTGATATAGG + Intronic
1039782350 8:40797857-40797879 GACAGGCAGCCTTTGGATATGGG + Intronic
1040864448 8:52034038-52034060 TACAGCCAATCTTTAGAGAAAGG + Intergenic
1047863676 8:128997243-128997265 TAAAGTCATCCAGTAGATATTGG + Intergenic
1048671074 8:136720917-136720939 GACAGCCATCATTTAGAAATTGG - Intergenic
1049942484 9:560937-560959 TTCAGCCAACCATTTGATATGGG + Intronic
1052036594 9:23688382-23688404 TACAGGCATCCTGTGGATATAGG - Intergenic
1057981168 9:99665333-99665355 TAAAGCCATCCTTTTTATTTAGG - Intergenic
1188114495 X:26226336-26226358 AACTGCCATTCTTTAAATATTGG + Intergenic
1188638344 X:32464797-32464819 TAGAGACATCCTTTAAACATGGG - Intronic
1194862464 X:99018097-99018119 TACAGCCAGCCTTCACTTATAGG - Intergenic
1195549379 X:106150003-106150025 GACATCAATCCTTGAGATATAGG + Intergenic
1197680446 X:129377204-129377226 TACAGCAATGCTTTAGGTGTAGG + Intergenic
1199230258 X:145428813-145428835 TACTGCCATCCCATATATATTGG - Intergenic