ID: 1107691714

View in Genome Browser
Species Human (GRCh38)
Location 13:42960121-42960143
Sequence ATACAGCCATCCTTTAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107691714_1107691717 28 Left 1107691714 13:42960121-42960143 CCATATCTAAAGGATGGCTGTAT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107691714 Original CRISPR ATACAGCCATCCTTTAGATA TGG (reversed) Intronic
903889331 1:26558970-26558992 ACTCAGCCATTCTTTAGAAAAGG - Intronic
904309685 1:29620811-29620833 ATAAATCCAACATTTAGATAAGG - Intergenic
904768659 1:32869282-32869304 AACCACCCATCCCTTAGATAGGG - Intronic
908435019 1:64097326-64097348 ATATAAACATCCTTTAAATATGG - Intronic
908680649 1:66657221-66657243 ATACAGCCATCCTATTTTTAAGG + Intronic
909597133 1:77418795-77418817 ATACAGCCAGCCATTACACATGG - Intronic
910116206 1:83734826-83734848 ATGCAGCTGGCCTTTAGATAAGG + Intergenic
910139378 1:84010105-84010127 TTACATCCATCTTATAGATAAGG + Intergenic
910433687 1:87183435-87183457 AAACGGCCATCTTTTAGACAGGG - Intergenic
912000503 1:104828525-104828547 ATACAGACAATCTTTAGATATGG - Intergenic
918453663 1:184685376-184685398 ATACAGCCATCCTTTGAAACAGG + Intergenic
921570584 1:216773667-216773689 ATAGAGCTATCTTTTATATAAGG + Intronic
1063868067 10:10388708-10388730 ACAAAGCCATGCTTAAGATATGG + Intergenic
1064929983 10:20614269-20614291 ATACAGACATACTTGAGATTGGG - Intergenic
1074704015 10:116115571-116115593 ATACAGCCAGCCTGTAACTAAGG + Intronic
1077831938 11:5882334-5882356 ACACAGCCACCCTTAAGATTGGG + Intronic
1081028153 11:38041625-38041647 CTACAGCCAGCCAATAGATAAGG + Intergenic
1081577944 11:44330990-44331012 CTACAGTCATTCTTTAGAGATGG + Intergenic
1081948426 11:47020211-47020233 ATGCAGCCATCATGTGGATAGGG - Intronic
1083350043 11:62021356-62021378 TTACAGAAATCCTTTAGTTAGGG - Intergenic
1085585309 11:77698019-77698041 ATCCAGCCATCCATGAGACAGGG + Intronic
1086269782 11:85048415-85048437 CTACAGCCATGATTAAGATAAGG + Intronic
1093444085 12:19234413-19234435 ATACAGCCACCGTTTACAGAAGG - Intronic
1095048291 12:37534150-37534172 ATGCAGCTGTCCTTTAGATGTGG - Intergenic
1095288107 12:40440384-40440406 ATCCAGCCATCCTTTCCACAAGG + Intronic
1097477902 12:60082042-60082064 AGAAAGCCATCCTTCAGAAATGG - Intergenic
1097941080 12:65306371-65306393 ATACATCCATTCTTTAGAACTGG + Intronic
1101255384 12:102972181-102972203 ATACAACTATCTTTTAGATCAGG + Intergenic
1101821106 12:108184847-108184869 AAACAGCCTTCCTTTACATAAGG - Intronic
1105572418 13:21615648-21615670 ATACTGGCAGCCTTAAGATAGGG - Intergenic
1107691714 13:42960121-42960143 ATACAGCCATCCTTTAGATATGG - Intronic
1108058492 13:46509000-46509022 ATACATCCATCTTACAGATAAGG + Intergenic
1109375851 13:61492038-61492060 ATACACCCTTCCTTTAAAAATGG + Intergenic
1110775127 13:79399717-79399739 AAACTGCAATCATTTAGATACGG + Intronic
1116782236 14:49249504-49249526 ATACAGCCTTCCTAATGATAAGG + Intergenic
1118736068 14:68702787-68702809 ATCCAGCCTTCCTTCAGAGACGG + Intronic
1120856075 14:89213538-89213560 AATCAGCCATCCTTAAGGTAGGG - Intronic
1124188501 15:27550972-27550994 CTACAGCCAACCTTTACATTTGG - Intergenic
1125356166 15:38819187-38819209 ATTCTGACATCCTTTAGATTAGG + Intergenic
1127928610 15:63573564-63573586 ATACAGCCATCTGTCAGATTTGG - Intronic
1138941831 16:61800822-61800844 ATACAGCTTTGCTTTTGATAAGG - Intronic
1142268922 16:89079076-89079098 ATACAGCCATCTTGTATACAAGG - Intergenic
1146840542 17:36150135-36150157 AGACAGACATCCTTTGGATCTGG + Intergenic
1156400422 18:36734456-36734478 ACACAGGCAGCCTTTAGATCAGG - Intronic
1158097918 18:53795876-53795898 ATGAAGCCATCCTTTAAATGAGG - Intergenic
1160122362 18:76142284-76142306 AAACAGCCATCCTACAGAAAAGG + Intergenic
1162714640 19:12622451-12622473 ATTCAGCATTCCTTAAGATATGG - Intronic
1165238835 19:34446954-34446976 ATACAACCATGTTTTAGAAAAGG - Intronic
1166496182 19:43304882-43304904 ACACAGACATCCTTTAGGTTTGG + Intergenic
1168011227 19:53534753-53534775 AACCAGCCACCCTTCAGATACGG - Intronic
927069010 2:19505971-19505993 ATAGAGCAATCCATTAAATATGG + Intergenic
927207742 2:20620762-20620784 ATACAGCCTTCCTGTACATTTGG - Intronic
938703672 2:133901043-133901065 AGAGATCCTTCCTTTAGATATGG - Intergenic
938756945 2:134389433-134389455 AAACAGCCTTCCTTTAAAAAAGG - Intronic
940197928 2:151116398-151116420 ATACAACCATCCTTTTTAAATGG - Intergenic
941684529 2:168434890-168434912 ATACCACCATGCATTAGATATGG + Intergenic
944869715 2:203897627-203897649 ATACAGCCATCATTTTCATGGGG + Intergenic
1172001070 20:31777441-31777463 ATACAGACAACATTAAGATAGGG - Intronic
1176988629 21:15466985-15467007 AGAAAGCCATCCTCTACATATGG + Intergenic
1183200138 22:36380259-36380281 AGACAGCCATCCTTGAGAAGGGG + Intronic
950176685 3:10879683-10879705 ATAAAGCCATGATTTTGATATGG - Intronic
955666910 3:61359041-61359063 TTACTGCCATCCATTAGACATGG - Intergenic
962093667 3:132271288-132271310 ATACAGGCAGCCTCTAGAAATGG + Intronic
962140792 3:132788796-132788818 ATACAGCCAGCCATTAGAATAGG + Intergenic
967710704 3:192704262-192704284 CAACAGCCATCCTATAGCTATGG - Intronic
967742858 3:193022274-193022296 ATACAGCCATGAATAAGATAAGG + Intergenic
972025911 4:34377375-34377397 ATACAGAATTCCTTTAGAGATGG - Intergenic
974770646 4:66407091-66407113 AGTCAGCCATCCTGTATATAAGG - Intergenic
976578797 4:86709361-86709383 ATACAGCTATGAATTAGATAAGG - Intronic
981249209 4:142579134-142579156 ATACAGCCAACATTTAAATGGGG + Intronic
984198240 4:176686052-176686074 TTACATCCATTCTTTACATATGG - Intronic
984607398 4:181801081-181801103 AAACAGCCCTCCTTTGGACAAGG + Intergenic
985352841 4:189084707-189084729 ATTCTGCCTTCCTATAGATAAGG + Intergenic
986939421 5:12932511-12932533 ATACATCATTCCTTTTGATATGG + Intergenic
989212933 5:38874822-38874844 AGACAGCAATTTTTTAGATAAGG - Intronic
990251248 5:53917376-53917398 ATACAGACACCTTTTAGACAAGG + Intronic
995825935 5:116299209-116299231 AAACTGCCATCATTTAGATTTGG - Intronic
997424832 5:133796087-133796109 ATACAGCTGTCCCTCAGATAAGG + Intergenic
997988663 5:138525544-138525566 CTAAAGCCAGCCTTTAGATCAGG - Intronic
1015297199 6:131609371-131609393 ATAAAACCATCATTTAGAAAGGG - Intronic
1018271421 6:162082404-162082426 ATACAGCCTTCCTCTGGATTAGG + Intronic
1024790983 7:52964690-52964712 AATCAGCCAACCTTAAGATAAGG + Intergenic
1030805878 7:113918386-113918408 TTACTGCCATCTTTTTGATAAGG + Exonic
1033501612 7:141956830-141956852 ATAGGGCCATCTTTTAGCTAGGG - Intronic
1035097982 7:156371528-156371550 ATACAGCCATACTGTGGTTAGGG + Intergenic
1035613214 8:982999-983021 ATAGAGCCTCCCTTTAGATAGGG + Intergenic
1038353666 8:26806240-26806262 CTACAGCCTTCCTTCAGACAAGG + Intronic
1040801425 8:51345861-51345883 ATACAGCTATCCTGTTGATAAGG - Exonic
1043794567 8:84520523-84520545 ACATAGACATTCTTTAGATAGGG + Intronic
1045442455 8:102227939-102227961 ATATAGACATCATTTTGATAGGG + Intronic
1045739304 8:105336093-105336115 ATACAATCATTCTTTAGAGAAGG + Intronic
1055579467 9:77692308-77692330 ATAAAGACATCCCTTAGATTGGG + Intergenic
1058173117 9:101706488-101706510 ATAAAGCCATTGTTTAGAAAGGG + Intronic
1058510304 9:105711090-105711112 ATATATCCATCATTTAGATTAGG + Intronic
1060886732 9:127160019-127160041 ATACAGCTATCTTTTTAATAAGG - Intronic
1190794978 X:53732374-53732396 ATAGAGCAATCCTTTCCATAGGG - Intergenic
1193560543 X:83011905-83011927 AAAAAGGCATCCTTTAGATCTGG + Intergenic
1194025318 X:88744550-88744572 ATAAAGACAAGCTTTAGATAAGG - Intergenic
1196655776 X:118215636-118215658 ATACAGACTTCCTCTAGAGATGG - Intergenic
1199730604 X:150628523-150628545 ATAAAGCCATGCTTTATATTTGG - Intronic