ID: 1107691717

View in Genome Browser
Species Human (GRCh38)
Location 13:42960172-42960194
Sequence CTCAAACATATGTAGATCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107691714_1107691717 28 Left 1107691714 13:42960121-42960143 CCATATCTAAAGGATGGCTGTAT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 103
1107691713_1107691717 29 Left 1107691713 13:42960120-42960142 CCCATATCTAAAGGATGGCTGTA 0: 1
1: 0
2: 1
3: 15
4: 97
Right 1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107691717 Original CRISPR CTCAAACATATGTAGATCGA AGG Intronic
903958521 1:27041505-27041527 TTCAAACATAGGTCTATCGAAGG + Intergenic
905258600 1:36701600-36701622 CTCCAACATTTGGAGATCCAAGG - Intergenic
905950685 1:41948070-41948092 CTCAAACCTATGCTGATTGAGGG + Intronic
907100938 1:51834895-51834917 CACAAACATATGCAGATTAATGG + Intronic
909444755 1:75736255-75736277 CTCAAACATATTTCAATCTAAGG + Intronic
911031056 1:93488707-93488729 ATCAAACATATGTAGGCCCAGGG + Intronic
911211640 1:95145593-95145615 TTCTAACATATGAAGATAGATGG + Intronic
911711289 1:101076652-101076674 CTAAAACAACTGTAGATCCAGGG + Intergenic
911793832 1:102052724-102052746 CTCAAACATTTGGAGATAGTTGG + Intergenic
919337451 1:196255498-196255520 CTCAAACACATCTAGCTCCAAGG - Intronic
919432567 1:197514682-197514704 TTCAAACATATGCAGAAGGAAGG - Intronic
923074182 1:230594656-230594678 CTCAAATATATGTAAATCTTAGG + Intergenic
924031105 1:239886601-239886623 AGCAAACATATGGAAATCGATGG - Intronic
1068860429 10:61842287-61842309 TTCAAAGATATGTAGATAGTTGG - Intergenic
1070286863 10:75089974-75089996 TTCAAACACAGGTAGATGGAGGG - Intergenic
1071944324 10:90624513-90624535 CTAAAACACATGTAGATTAAAGG + Intergenic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1078525144 11:12095034-12095056 CTCAAACACATGTTGATGAAAGG + Intronic
1087166846 11:95013255-95013277 ATCAAACAAATGTAGACCAAAGG + Intergenic
1089665774 11:120017737-120017759 CTCAAAGATATGCAAATCCAAGG + Intergenic
1091975918 12:4825062-4825084 CTCAAACACAAGTAGCTTGAAGG - Intronic
1093109461 12:15131922-15131944 CTTAAACATATGGAGAACCAGGG + Intronic
1093284385 12:17240370-17240392 CTCAAATATAGGTAGAGTGATGG - Intergenic
1105225435 13:18427198-18427220 CTCAACCATCTGCAGTTCGAGGG + Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1109580381 13:64323739-64323761 CTGAAACATATGTAAACCTAGGG - Intergenic
1110390162 13:74964231-74964253 CTAAAACATATATAGACCAATGG + Intergenic
1111852741 13:93597520-93597542 TTCAAACATATGTTGCTCAAGGG - Intronic
1114384605 14:22242260-22242282 CTCAAACCTATGCCGCTCGAGGG + Intergenic
1116027580 14:39534130-39534152 CCCAAACAGATATAGAGCGAGGG - Intergenic
1116447157 14:45023218-45023240 CTCAAACCTATGCCGCTCGAGGG - Intronic
1119568714 14:75650984-75651006 CTCATGCATCTGTAGATAGAAGG + Exonic
1121535598 14:94688517-94688539 CTCTAACCTATGTTGATTGATGG - Intergenic
1125454479 15:39843317-39843339 CTCAATCATATGTATTTCAAAGG + Intronic
1131748033 15:95471311-95471333 CTTAAACATATGTAGCTTTAAGG + Intergenic
1142721403 17:1778415-1778437 CTCAAACATTTGTAGAATGAAGG - Intergenic
1150072141 17:62160343-62160365 ATTAAAAATATGTAGATGGAGGG - Intergenic
1154527936 18:15312325-15312347 CTCAACCATCTGCAGTTCGAGGG - Intergenic
1157346188 18:46836425-46836447 CTCATTCATTTGTAGATAGAGGG + Exonic
1159786025 18:72715355-72715377 CTGAAACAAATTTAGATAGAAGG - Intergenic
1167869570 19:52356536-52356558 CTCAAAAATATATAAATCAATGG - Intronic
1167872109 19:52379196-52379218 CTCAAAAATATATAAATCAATGG - Intronic
928813535 2:35259442-35259464 ATCAAATATATGTAGATAAAGGG + Intergenic
931782132 2:65587883-65587905 CACACACATATGCAGATCGCTGG - Intergenic
938527036 2:132143782-132143804 CTCAACCATCTGCAGTTCGAGGG - Intergenic
942468958 2:176239898-176239920 CTCAGGCACATGTAGATGGAAGG + Intergenic
1169617384 20:7464086-7464108 CTCAAAAAAATGTAGAGCTATGG + Intergenic
1171722325 20:28575924-28575946 CCTTAACATATGTAGATCAAGGG + Intergenic
1171755758 20:29107537-29107559 CCTTAACATATGTAGATCAAGGG - Intergenic
1171786917 20:29475354-29475376 CCTTAACATATGTAGATCAAGGG + Intergenic
1171861039 20:30404020-30404042 CCTTAACATATGTAGATCAAGGG - Intergenic
1174744020 20:53043894-53043916 CTCAAACATCTGTACTTCGCTGG + Intronic
1176769488 21:13056221-13056243 CTCAACCATCTGCAGTTCGAGGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179896884 21:44368118-44368140 CTCAAAAATAAATAGATGGATGG - Intronic
1180295874 22:10934616-10934638 CCTTAACATATGTAGATCAAGGG + Intergenic
1180412797 22:12631405-12631427 CCTTAACATATGTAGATCAAGGG - Intergenic
1180516590 22:16150165-16150187 CTCAACCATCTGCAGTTCGAGGG + Intergenic
951930903 3:27966189-27966211 CTCAAACAGAGATAGATCAATGG + Intergenic
953866306 3:46586101-46586123 TTCAAACATATGTTGCTCAAGGG + Intronic
956999982 3:74874270-74874292 CTCAAACCTATGCTGCTCGAGGG - Intergenic
959830853 3:110860622-110860644 CTGAAACCTATGTTGTTCGAGGG + Intergenic
971888026 4:32478217-32478239 CTCAAATATTTTTAGATAGATGG - Intergenic
977527976 4:98167156-98167178 CTCAAACAAATCTAGAGGGAGGG - Intergenic
978155744 4:105488021-105488043 CTCAAACCTATGCTGCTCGAAGG + Intergenic
979442933 4:120773760-120773782 CTCACAGATATGTAGTTAGAAGG - Intronic
980763994 4:137274708-137274730 TTCAAAGATATGAAGATCAAAGG - Intergenic
980764685 4:137286498-137286520 CTAAAACATATGAATTTCGAGGG + Intergenic
982954340 4:161743394-161743416 CTAAAACATATGTAGACCAATGG - Intronic
984396437 4:179207376-179207398 CTAAAACATATTTAGATTCATGG - Intergenic
987558988 5:19494222-19494244 CTAAAACATAAATAAATCGATGG - Intronic
988109759 5:26803900-26803922 CTCACACATATGTATATACATGG - Intergenic
991135531 5:63177556-63177578 CTCAAACTTATGGAAATAGAAGG - Intergenic
995160698 5:108977500-108977522 TTCAAACCTATGTAGTTCAAGGG + Intronic
996999984 5:129747975-129747997 CTCACACACATGTACATGGAGGG - Intergenic
998630997 5:143898501-143898523 CTCAAATATTTGTAGAAGGAAGG - Intergenic
999893283 5:156001896-156001918 CTCAAAAATATGTACTTCTAAGG + Intronic
1002877541 6:1225074-1225096 CTCTAAAATATGTAGAAGGAGGG - Intergenic
1004211103 6:13645328-13645350 CTCAAATATATGTATTTCAAGGG + Intronic
1004757250 6:18625093-18625115 TTCAAACATATCTCGATTGATGG + Intergenic
1005743714 6:28816440-28816462 CTAAAAGATAAGTAGATCGCAGG - Intergenic
1006707301 6:36031703-36031725 CTCAAAAAAATGAAGATGGATGG - Intronic
1007685819 6:43666773-43666795 CTCAAATATATGTATATATATGG - Intronic
1012007771 6:93735971-93735993 TTCAAATATATGTTGATTGATGG + Intergenic
1016479130 6:144462814-144462836 CTCAAGCAAATGTAGATCTTTGG - Exonic
1020679406 7:11218609-11218631 CTCAGACATGGTTAGATCGAAGG - Intergenic
1029310719 7:99661130-99661152 CTCAAACATATATAGAGAAAAGG - Intronic
1031523956 7:122801152-122801174 CTCAAAAATATGTACATATAGGG + Intronic
1031817366 7:126454582-126454604 CTCCAACATTTGTATTTCGAAGG + Intronic
1034219807 7:149435169-149435191 CTCAAAAATATGTACATATATGG - Intronic
1035091499 7:156316656-156316678 CACAAACACATGTAGATAGCTGG - Intergenic
1041867815 8:62596790-62596812 CTCAAACCTATGCTGTTCGAGGG - Intronic
1042960185 8:74295026-74295048 TTCAAACTTATGTAGGTCCAGGG - Intronic
1044620201 8:94183376-94183398 CATAAACATATATAGATCAATGG + Intronic
1046972764 8:120240730-120240752 CTTAAACATATGTAAAACAAGGG + Intronic
1049049984 8:140187111-140187133 GTCAAACCTATGTAGTTCGAGGG - Intronic
1049735146 8:144200990-144201012 GTCACACATATGTAAATTGAGGG - Intronic
1053705731 9:40751133-40751155 CTCAACCATCTGCAGTTCGAGGG - Intergenic
1054415808 9:64874740-64874762 CTCAACCATCTGCAGTTCGAGGG - Intergenic
1057570674 9:96202059-96202081 CTCAAAAATCTGTACCTCGAAGG - Intergenic
1202802729 9_KI270720v1_random:15622-15644 CCTTAACATATGTAGATCAAGGG + Intergenic
1203447515 Un_GL000219v1:72829-72851 CCTTAACATATGTAGATCAAGGG + Intergenic
1186706554 X:12145980-12146002 CTCAAAAGTATGTAGACGGAGGG - Intronic
1196006842 X:110845601-110845623 GTCAAAGATATGTAGATATATGG + Intergenic
1196133655 X:112183700-112183722 CTTAAACAAATGTAGATGGCGGG + Intergenic
1196936698 X:120737477-120737499 CTAAATCATATGTAGATGAAAGG - Intergenic
1200790067 Y:7291734-7291756 GTGAAACATATGGAGATGGAGGG - Intergenic