ID: 1107692235

View in Genome Browser
Species Human (GRCh38)
Location 13:42965466-42965488
Sequence CCCTCAAAGCAGGATCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107692231_1107692235 -5 Left 1107692231 13:42965448-42965470 CCAAAGGGAGGTAATGGCCCCTC 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 174
1107692226_1107692235 11 Left 1107692226 13:42965432-42965454 CCGAGCGCTTCAAATTCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107692235 Original CRISPR CCCTCAAAGCAGGATCTGCA AGG Intronic
900690855 1:3979463-3979485 CCCTCAAAGCAGCAAGTTCAAGG - Intergenic
900934337 1:5755808-5755830 CCCTGACAGCAGGAGCTCCAGGG + Intergenic
900939462 1:5788847-5788869 ACCTCAGTGCAGGATCTTCATGG - Intergenic
903227152 1:21900236-21900258 CCGCCAAACCAGGAACTGCAGGG - Intronic
903719037 1:25390748-25390770 CCCCCAAAGGAAGATCAGCATGG - Exonic
905300863 1:36985439-36985461 GCCTCACAGCATGATCTTCATGG + Intronic
905970146 1:42135656-42135678 CCCTCCAAGCAGGCACTGCTGGG + Intergenic
907838446 1:58133409-58133431 CCCAGAGAGCAGGATCTCCAAGG - Intronic
918433296 1:184484516-184484538 CCCCGAAGGCAGGAACTGCATGG + Intronic
920960008 1:210655619-210655641 CCCTCAGAGCAGGGTCTGTAAGG + Intronic
921632982 1:217456521-217456543 TCCTCAAAGCAGTGTCAGCAGGG + Intronic
922891092 1:229062438-229062460 CCCTCAAATCGGGACCTGCGGGG + Intergenic
1064538941 10:16386877-16386899 TCCTCAAATCAGGATGTGCAGGG + Intergenic
1064742225 10:18445560-18445582 CTCTCTAAGCAAGATGTGCATGG + Intronic
1067097231 10:43309847-43309869 CCCTCAAAGCATGATCTATCTGG - Intergenic
1070190104 10:74104511-74104533 CAGTCACAGCAGGTTCTGCAGGG - Intronic
1070670937 10:78376749-78376771 CTCTCAGAGCAGGCTCTGCCAGG - Intergenic
1072569055 10:96642730-96642752 CCCTCACAGCAGGATCAGTGAGG - Intronic
1073330670 10:102668306-102668328 CCCTCAAAGGAGGATCAGGCAGG + Intergenic
1075974763 10:126685724-126685746 CCCTAAAAGAAGGGCCTGCAGGG + Intergenic
1076064423 10:127438112-127438134 TCCTCACAGCAGGAGCTGCTAGG + Intronic
1076291392 10:129348543-129348565 CCCTCCAAGCCGGGGCTGCATGG + Intergenic
1076854212 10:133108003-133108025 GCCACACAGCAGGATGTGCAGGG - Intronic
1077420672 11:2448466-2448488 CCCTGAGAGCTGGCTCTGCATGG - Intronic
1077538842 11:3137123-3137145 TCCTCACAGCAGGATCTTCATGG - Intronic
1079136388 11:17778127-17778149 CCCTCAAAGCAGAATCTTCCTGG - Intronic
1079849742 11:25516272-25516294 CCCTCAAGCCAGGATATACACGG - Intergenic
1080637770 11:34138784-34138806 GCCTCACAGCAGGAACTCCAGGG - Intronic
1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG + Exonic
1084128830 11:67118618-67118640 GCCTCAAAGCAGGGTCTCCCGGG - Intergenic
1084230118 11:67746134-67746156 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
1084801080 11:71544572-71544594 CCCACAAAGGACGCTCTGCAGGG - Intronic
1086167651 11:83798065-83798087 CCTTCTAAGCAGCATCTCCAAGG - Intronic
1087416667 11:97864942-97864964 CTCTCAATGCAGAATCTACAGGG + Intergenic
1087788668 11:102384397-102384419 CCCTCATCGCATGCTCTGCAAGG - Intergenic
1089007560 11:115105275-115105297 CCCTCAAAGCAGGTGCAGCTGGG - Intergenic
1094828627 12:34289724-34289746 CCTTCAAAGCAGCCCCTGCATGG - Intergenic
1099789186 12:87309557-87309579 CACTCATAGAGGGATCTGCAAGG + Intergenic
1102349724 12:112183630-112183652 CTCTCCCAGCAGGCTCTGCAAGG - Intronic
1104095042 12:125549349-125549371 CTCACACAGCAGGATCTGAAAGG - Intronic
1104320351 12:127745050-127745072 CCCGCACAGCCGGTTCTGCATGG - Intergenic
1104346332 12:128002835-128002857 TTCTCAAATCAGGATCTGCTGGG - Intergenic
1104934709 12:132358260-132358282 CCCTCAGAGCAGCAACAGCAAGG + Intergenic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1111670204 13:91320496-91320518 CCATCATTGGAGGATCTGCAGGG - Intergenic
1115398789 14:32936787-32936809 CCCTCAAGGCAGGAGCACCAGGG + Intronic
1116764199 14:49050785-49050807 CTCTCAAAGCAGAAACTGTAAGG + Intergenic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1118221690 14:63860284-63860306 CCCTCCAGACAGGTTCTGCAGGG + Intronic
1118922206 14:70159792-70159814 TCCTCAAAGCAGGCTCTCCTGGG - Intronic
1119645582 14:76346236-76346258 CCTTAAGGGCAGGATCTGCATGG - Intronic
1121187650 14:91990130-91990152 CCCTAAAAGCAGGATCAGTAGGG - Intronic
1123043837 14:105501874-105501896 CCCTCAAGGCAGGGTCAGCCAGG - Intergenic
1124416284 15:29475434-29475456 ACCTCAGAGCAGGATCTGGAAGG + Intronic
1124461298 15:29894706-29894728 CCCTCACAGCAGCCTCTGCTTGG + Intronic
1125502804 15:40250011-40250033 TCCTCAAAGGAGGATGTGCCTGG + Intronic
1125907570 15:43407556-43407578 CCCCTAAAGCAATATCTGCAAGG + Exonic
1127300403 15:57647549-57647571 CCCTGAAAGCAGGACTTACATGG - Intronic
1127319730 15:57831315-57831337 CCCTCAGAGAAGGAGCTGGAAGG + Intergenic
1127774296 15:62253428-62253450 AGCTCAAAGCAGGGGCTGCACGG + Intergenic
1129004128 15:72358050-72358072 CACTCAAGGCAGAATCTGCAGGG + Intronic
1129506762 15:76088056-76088078 CCCTCAAAGCACCCTCAGCATGG + Intronic
1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG + Intronic
1133035514 16:3031717-3031739 CCCTCAAAGCGGGATGGGCCTGG + Intronic
1136450654 16:30352741-30352763 ACCTCCAAGAAGGATCTTCATGG + Exonic
1140554335 16:75904094-75904116 CTCTCAAAGCAAGTTCTGTATGG + Intergenic
1140787174 16:78353773-78353795 ACCTGCAGGCAGGATCTGCAAGG + Intronic
1141518565 16:84562665-84562687 TCCTCAGGGCAGGAGCTGCACGG + Intergenic
1141624128 16:85252584-85252606 CCCCCGAAGGAGGATCTTCAGGG - Intergenic
1141687123 16:85576944-85576966 CCCTGAATGCAGGCCCTGCATGG + Intergenic
1142806823 17:2375764-2375786 CCCTCAAAGTGTGAGCTGCAGGG - Exonic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1144164657 17:12598016-12598038 CCATCACAGCTGGATTTGCAAGG - Intergenic
1145836107 17:27955415-27955437 CTCTCAGAGCAGGAACTGTAAGG - Intergenic
1146405327 17:32531765-32531787 ACCTGAAAGCATGATCAGCATGG + Intronic
1147682419 17:42259338-42259360 CTCTGAAAGCAGGAGCTTCAAGG + Intronic
1150659051 17:67059641-67059663 CCTTCAGAGCAGGGCCTGCATGG - Intergenic
1152141265 17:78538222-78538244 CACACAAAGCAGGTACTGCAGGG + Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1154324990 18:13383448-13383470 CCATCAAAGAAGCATCTCCAGGG + Intronic
1157393078 18:47319144-47319166 CACTCACAGCAGGAACTGCTAGG - Intergenic
1157616579 18:48991042-48991064 CCTTCATAACAGGTTCTGCAGGG - Intergenic
1160941224 19:1621334-1621356 CCCTGAAACCAGCCTCTGCAGGG + Intronic
1162627167 19:11893999-11894021 CCTGCAAAGCAAGATATGCATGG + Intronic
1165258265 19:34592916-34592938 CCCTCAATGCAGAACCTCCAGGG - Intergenic
1166610218 19:44185227-44185249 AACTCAAAGCAGGATCTCAAAGG - Intergenic
1167106865 19:47435500-47435522 ACCTCAAAGGAGCCTCTGCAGGG + Intronic
1167958602 19:53087942-53087964 ACCTCAGAGGAGGGTCTGCAGGG + Intronic
1168115196 19:54218399-54218421 CCTTCACAGCAGCATCTGCTGGG + Exonic
925613704 2:5725319-5725341 CCCTCATAGCTGGAACTACAGGG + Intergenic
927313117 2:21652493-21652515 CCCTGAAAGATGGATCTGAACGG + Intergenic
928174082 2:29022534-29022556 CCCTCCAAGCAGCCTATGCATGG + Intronic
928266833 2:29819092-29819114 CCCTCCAATCAGGATCATCAGGG + Intronic
929544342 2:42846037-42846059 CCCTGAAACCCGGGTCTGCAGGG - Intergenic
929845385 2:45520505-45520527 CCCTCAAACCTGGATATCCATGG + Intronic
936661312 2:114547137-114547159 ATCTCAAAGCAGCAACTGCAGGG - Intronic
937061797 2:118985542-118985564 CCCTGAGAGAAGGTTCTGCAGGG - Intronic
937251906 2:120529228-120529250 GCAGCAAAGCAGGAGCTGCAGGG + Intergenic
937346285 2:121127814-121127836 CCCTGAAACCAGGCTCTGCCTGG + Intergenic
937357222 2:121205598-121205620 CCTTCAAAGCAGGTTTGGCATGG + Intergenic
945478070 2:210309553-210309575 ACCTCAAAGCAGAATTTGAAGGG - Intronic
948815410 2:240507784-240507806 CCCTGAAAGCAGGGGCTTCACGG + Intronic
1172025331 20:31944467-31944489 CCCTCAGAACAGCACCTGCAGGG - Exonic
1173658177 20:44715365-44715387 GGCTCAAAGCTGGCTCTGCAGGG + Exonic
1173701566 20:45076422-45076444 CCCCCAAAGAAGGGGCTGCATGG - Exonic
1174147367 20:48461292-48461314 CCCGCACAGCCGGCTCTGCATGG - Intergenic
1175391731 20:58631799-58631821 CCCTCAAACCAGGCTTTGCTGGG - Intergenic
1175491054 20:59381500-59381522 GCCTCAGAGCAGTGTCTGCAGGG + Intergenic
1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG + Exonic
1176660779 21:9633616-9633638 CCCTCTATGCTGGATCTGCGAGG + Intergenic
1177322997 21:19546126-19546148 CCCACAAAGCAGGATATGGTTGG + Intergenic
1178177626 21:30121995-30122017 CCATCAAAGCAGAATGTCCATGG - Intergenic
1178429553 21:32506901-32506923 CCCCCAAAGCAGGAGCAGCTGGG + Intronic
1178978823 21:37244024-37244046 CCCTCGAAGCAGGCTCTGAGTGG - Intronic
1182123320 22:27800384-27800406 CGCTCATAGCAGGATCCACAGGG + Exonic
1182342939 22:29639010-29639032 CCCTCAAAGAAGCCTTTGCAAGG - Intronic
1182594618 22:31409468-31409490 CCTTCAAATCAGAATCTGCAGGG + Intronic
1183003354 22:34879858-34879880 TCCTCAAAGCAGGAATTCCAAGG - Intergenic
1184030597 22:41892117-41892139 CCCACAAAGCTGGCCCTGCAAGG - Intronic
1184956459 22:47890079-47890101 CCCTCCAGGCTGGATCTTCATGG - Intergenic
1185247528 22:49781090-49781112 CCATCAACACAGGAGCTGCACGG + Intronic
950013602 3:9741059-9741081 CCCTCAAACCAGGATCAGCATGG + Intronic
950115584 3:10448636-10448658 CCCTCAAGGCAGGACATACAAGG + Intronic
952862823 3:37829004-37829026 CCCATAAAGCAGCATCTCCAAGG - Intergenic
953413893 3:42704611-42704633 CACACACAGCAGGGTCTGCAGGG + Intronic
957046686 3:75381162-75381184 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
959090951 3:101902068-101902090 CCCTGAAAGCAAGATCAGAATGG - Intergenic
961878751 3:130045230-130045252 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
963834018 3:150038039-150038061 CCTTCAAAGCAAGTTCTGCCTGG - Intronic
967721377 3:192819882-192819904 TCCCCAGAGCAGGAGCTGCAGGG - Intronic
968293144 3:197554646-197554668 CCCTCAAAGTAGGAACTGCAGGG + Exonic
968642048 4:1719876-1719898 TCCTCAAACCAGGATGTGGAGGG + Intronic
969824365 4:9745257-9745279 CCCCCAAAGCAGGAGCAGCTGGG + Intergenic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
971567155 4:28159952-28159974 CCCTTAATGAAGGAACTGCAAGG - Intergenic
977670637 4:99691644-99691666 ACCTCATACCAGGGTCTGCAGGG + Intergenic
978069365 4:104447567-104447589 CTCACCCAGCAGGATCTGCAAGG + Intergenic
979189180 4:117835293-117835315 CCCTCATCGCAGGACCTGCAAGG - Intergenic
981127570 4:141124044-141124066 ACCTTAAAGCAGGAGCTGAAGGG - Intronic
991474828 5:67008164-67008186 CCCTCAAAGCAGCAGGTGAATGG - Intronic
992778189 5:80106069-80106091 TCCTCTGAGAAGGATCTGCAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
1000186288 5:158861402-158861424 CACTCAAGCGAGGATCTGCAGGG + Intronic
1000352708 5:160364746-160364768 CCCTCAGAGCAGAAACAGCAAGG - Intronic
1001559578 5:172660274-172660296 CCCTCAAAGCATGCTCAGCCAGG - Intronic
1002756141 6:162006-162028 ACCTCACACCAGGACCTGCAGGG + Intergenic
1005821842 6:29605196-29605218 CCCTCAAGGCAGGAACTCCCAGG + Intronic
1008095585 6:47336353-47336375 CCCTCAAGGCAGGGTTTGCTTGG - Intergenic
1013609954 6:111785300-111785322 CCCTCAAGGCACTATCTGTAGGG - Intronic
1013864499 6:114679031-114679053 CCCACAGGGCAGCATCTGCATGG + Intergenic
1018917994 6:168149473-168149495 CCCTCAAAGCCGAATGTGAAAGG - Intergenic
1019096838 6:169588652-169588674 CCCTTACAGCAGCAACTGCACGG - Intronic
1020313807 7:6890158-6890180 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
1021926033 7:25534643-25534665 TCCTCAAAGGAGGTTCTGAATGG - Intergenic
1021926806 7:25541787-25541809 CCCTCAAAGCAGGAAATTAAAGG - Intergenic
1029436284 7:100565780-100565802 CCATCAAAGCCGGAGCTCCAGGG + Exonic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1034672177 7:152867236-152867258 CCCTCCAAGCCCGCTCTGCAAGG + Intergenic
1035209174 7:157315127-157315149 CCCACAAAGGACGATTTGCAGGG - Intergenic
1036391168 8:8325405-8325427 CCCTCTAAACAGGAGCCGCAGGG - Intronic
1040326597 8:46346779-46346801 CTCTTATTGCAGGATCTGCAAGG + Intergenic
1041106983 8:54453922-54453944 CCCGCACTGCAGCATCTGCAGGG + Intergenic
1042563303 8:70089809-70089831 CCCTCAAAGCAGGTTCTTAAAGG - Intergenic
1044620500 8:94186741-94186763 CACTCAGAGCATGAGCTGCAAGG - Intronic
1044967413 8:97586584-97586606 CCCTCAAAGGAGGATGTTCTTGG + Intergenic
1046244816 8:111545361-111545383 CCCTCAAAACAGGAGCTGTCAGG + Intergenic
1048508221 8:135039980-135040002 GCCTTGAAGGAGGATCTGCATGG - Intergenic
1048707020 8:137165192-137165214 TCCTGAAAGAAGGATCTGGATGG - Intergenic
1049228563 8:141470130-141470152 CCTTCAGGGCAGGTTCTGCAGGG + Intergenic
1049460650 8:142726279-142726301 CCCTCAAAGAAGGAGCTCCCTGG - Intergenic
1051640105 9:19216702-19216724 CCCTCAAAGCAGAATCAAAAAGG - Intergenic
1056546245 9:87616282-87616304 CCCTCAAAGAAACATATGCAAGG - Intronic
1057110549 9:92466130-92466152 GCCTCAAAGGAGGTTCTTCAGGG + Intronic
1057817029 9:98303499-98303521 CCTCCAGAGCAGGATCTGCTGGG - Intronic
1059087975 9:111325040-111325062 CTCTCTCAGCAAGATCTGCAAGG + Intergenic
1061064465 9:128268718-128268740 AGCTCAAAGCAGGGGCTGCACGG + Intronic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1203563486 Un_KI270744v1:75656-75678 CAGTCAGAGCAGGAGCTGCAGGG + Intergenic
1203638347 Un_KI270750v1:135460-135482 CCCTCTATGCTGGATCTGCGAGG + Intergenic
1185955833 X:4487960-4487982 ACCTTAAAGCAGGAGCTGAAGGG + Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1186839803 X:13474076-13474098 CCCTCAAAGCCGTTTCTGCAGGG + Intergenic
1189566084 X:42242594-42242616 CCCTGAAAGCAGAGCCTGCAAGG + Intergenic
1189653120 X:43211308-43211330 CCCTGCAAGCAGGTGCTGCAAGG - Intergenic
1189992901 X:46611573-46611595 CCTTCACAGCAGGTTCTGCCTGG - Intronic
1194324027 X:92488766-92488788 CCCTCAGATCAGAATTTGCATGG - Intronic
1200096697 X:153667924-153667946 TCCCCAAGGCAGGATTTGCAGGG + Intergenic
1200632130 Y:5601859-5601881 CCCTCAGATCAGAATTTGCATGG - Intronic