ID: 1107694264

View in Genome Browser
Species Human (GRCh38)
Location 13:42985192-42985214
Sequence CATTGCAATGGGAATACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 2, 2: 6, 3: 15, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107694258_1107694264 9 Left 1107694258 13:42985160-42985182 CCCAAAGAAAATCATATTTATTC 0: 1
1: 0
2: 12
3: 94
4: 742
Right 1107694264 13:42985192-42985214 CATTGCAATGGGAATACAGTGGG 0: 1
1: 2
2: 6
3: 15
4: 164
1107694259_1107694264 8 Left 1107694259 13:42985161-42985183 CCAAAGAAAATCATATTTATTCT 0: 1
1: 0
2: 5
3: 90
4: 838
Right 1107694264 13:42985192-42985214 CATTGCAATGGGAATACAGTGGG 0: 1
1: 2
2: 6
3: 15
4: 164
1107694257_1107694264 12 Left 1107694257 13:42985157-42985179 CCTCCCAAAGAAAATCATATTTA 0: 1
1: 0
2: 7
3: 63
4: 620
Right 1107694264 13:42985192-42985214 CATTGCAATGGGAATACAGTGGG 0: 1
1: 2
2: 6
3: 15
4: 164
1107694256_1107694264 13 Left 1107694256 13:42985156-42985178 CCCTCCCAAAGAAAATCATATTT 0: 1
1: 0
2: 5
3: 58
4: 687
Right 1107694264 13:42985192-42985214 CATTGCAATGGGAATACAGTGGG 0: 1
1: 2
2: 6
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107694264 Original CRISPR CATTGCAATGGGAATACAGT GGG Intronic
901103719 1:6738892-6738914 CGTTCCTATGGGAACACAGTAGG - Intergenic
901268273 1:7929517-7929539 CATTGCAGTGGGAATACGGTGGG - Intronic
906614874 1:47227078-47227100 CACTGCTCTGGGAATACAGGAGG - Intronic
906634685 1:47401237-47401259 CCAGGCAGTGGGAATACAGTGGG - Intergenic
908418723 1:63938537-63938559 CAAGGCACTGGGAATACAGTGGG - Intronic
908764013 1:67538120-67538142 CATGCCAATGGGAATAAAGTAGG - Intergenic
911079847 1:93917580-93917602 CATTGTAATGGGGAAACAGTAGG - Intergenic
912222363 1:107692872-107692894 CATTGGAAGGGAAATACTGTTGG - Intronic
912436172 1:109662699-109662721 CATTCTAGTGGGGATACAGTAGG - Intronic
912438224 1:109677135-109677157 CATTCTAGTGGGGATACAGTAGG - Intronic
912440738 1:109695607-109695629 CATTCTAGTGGGGATACAGTAGG - Intronic
912675387 1:111675551-111675573 CAAAGCAATGGGAATAAAGCTGG - Intronic
915772718 1:158445664-158445686 CACAGCAATGAGAAAACAGTTGG + Intergenic
916484580 1:165247429-165247451 CATTCTAATGGGTATACACTTGG - Intronic
916587514 1:166161422-166161444 CATTGCAATTGGAATAAAATGGG - Intronic
919031061 1:192243099-192243121 CTAGGCAGTGGGAATACAGTTGG - Intergenic
919059647 1:192615494-192615516 CCTTGTAGTGGGAATAAAGTAGG - Intergenic
920548614 1:206839339-206839361 GAATGCAATGTGATTACAGTTGG + Intronic
1070993466 10:80753783-80753805 CATTTCAATGGGATTTCAGCTGG + Intergenic
1072782946 10:98262496-98262518 CATAGCAATTGGCACACAGTGGG - Intronic
1073584149 10:104692523-104692545 CACTGGGATGGGCATACAGTGGG + Intronic
1074744435 10:116517580-116517602 CAGTGCCATGGTAATACAGTCGG - Intergenic
1075093320 10:119455301-119455323 CATTGCAATAGAAATCCAATTGG + Exonic
1077563941 11:3284300-3284322 CACTGCACTGGGAAGTCAGTCGG - Intergenic
1077569831 11:3330117-3330139 CACTGCACTGGGAAGTCAGTCGG - Intergenic
1080159647 11:29158485-29158507 AAGTACAATGGGAAAACAGTGGG - Intergenic
1080196547 11:29616605-29616627 CATTGCAGTGGGAATATAATGGG + Intergenic
1080927667 11:36774962-36774984 CAATACACTGGGAATCCAGTGGG - Intergenic
1080962743 11:37179438-37179460 AATTGAAATTGGAATAAAGTCGG + Intergenic
1083877625 11:65532629-65532651 CATGGCTATGGGGATAGAGTGGG + Intronic
1085876726 11:80416407-80416429 CACTGTGCTGGGAATACAGTGGG + Intergenic
1086182218 11:83966463-83966485 CATGGCAGTGGCATTACAGTGGG + Intronic
1086570127 11:88273655-88273677 AAGTGCAATGGTAATTCAGTGGG + Intergenic
1090496512 11:127217958-127217980 CAGTGCAAGGAGAATACAATGGG + Intergenic
1092457070 12:8653388-8653410 CACTGCCCTGGGAGTACAGTAGG + Intronic
1094476145 12:30842131-30842153 CATTGCAAGGAAAAGACAGTGGG - Intergenic
1102322916 12:111953744-111953766 CACTGCAATGGGAATATGATGGG - Intronic
1103085433 12:118059485-118059507 CATTGTAAAGGAAATACAATGGG - Intronic
1104249193 12:127074698-127074720 TATTGCAATGGAAATGCATTAGG + Intergenic
1106177578 13:27344268-27344290 CATCGCAGTGGGAATGGAGTTGG + Intergenic
1107009258 13:35651841-35651863 CATTTCAATGGGAAGATGGTGGG - Exonic
1107694264 13:42985192-42985214 CATTGCAATGGGAATACAGTGGG + Intronic
1110481335 13:75980982-75981004 CATTCCAAAGGGAAGAAAGTTGG + Intergenic
1110725179 13:78814673-78814695 TATTGCATTGGGCACACAGTTGG - Intergenic
1111173555 13:84562188-84562210 TGTTGGAATGGGAATACAGATGG + Intergenic
1111539656 13:89654104-89654126 CATTGCAATGGTAACATGGTGGG - Intergenic
1112895380 13:104293144-104293166 CATTGCAATAGGTGTGCAGTAGG + Intergenic
1116175630 14:41466541-41466563 CTTTGAAATGGGAAGATAGTAGG - Intergenic
1117609826 14:57471034-57471056 CATTGAAATTGGACTACATTTGG - Intronic
1117721472 14:58632894-58632916 CCAGGCACTGGGAATACAGTGGG - Intergenic
1118180805 14:63491072-63491094 CTTTGCAACGTGAATACAGCTGG + Intronic
1118675678 14:68182041-68182063 TTTTGCCATGAGAATACAGTGGG + Intronic
1120814317 14:88838091-88838113 CATTTTAATGGGAATAAAGATGG - Intronic
1120885298 14:89447246-89447268 CATTACAACGGGAATACCCTTGG - Intronic
1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG + Intronic
1127062817 15:55204780-55204802 CAGAGCAATGGGAATATAGCGGG + Exonic
1128111428 15:65078547-65078569 CACTGTATTGGGCATACAGTAGG - Intergenic
1129673372 15:77619410-77619432 GATTACAATGGGATAACAGTGGG - Intronic
1130785004 15:87086345-87086367 CACTGAAATGGGAATCCACTAGG + Intergenic
1131705805 15:94994352-94994374 CATTGTTATAGGAATAAAGTAGG + Intergenic
1132293236 15:100717718-100717740 CATTGCAATGGGCACGCAGCTGG + Intergenic
1133342480 16:5045615-5045637 CATTGTATTTGGCATACAGTAGG - Intronic
1134294130 16:12930146-12930168 CTAGGCACTGGGAATACAGTAGG - Intronic
1136735530 16:32462953-32462975 CATGGCAAAGGGAACAGAGTGGG - Intergenic
1137225486 16:46502724-46502746 CAATAAAATGGGAATACAATGGG - Intergenic
1140614404 16:76643797-76643819 CATTGCATTGGAAAGACGGTAGG + Intergenic
1148527705 17:48357149-48357171 CATTGTATAGGGAATACAGAAGG + Intronic
1148727997 17:49809878-49809900 CACTACAATGGGAATACATAAGG - Intronic
1149056731 17:52375859-52375881 CATTGAAATGGGAATATTGTTGG + Intergenic
1150459125 17:65332591-65332613 TCTTGCAGTGGGAATGCAGTGGG - Intergenic
1153057481 18:960907-960929 CTTTGACAAGGGAATACAGTTGG + Intergenic
1155161665 18:23201255-23201277 CAATGCAATGCCAATACAGAGGG + Intronic
1157925380 18:51759406-51759428 CATTGCAATGGGAATATGCATGG + Intergenic
1158124236 18:54083885-54083907 CAGGGCAATGGGAATACAGAGGG - Intergenic
1158176274 18:54660078-54660100 CATTACACTGGGAATACAGGGGG + Intergenic
1158304186 18:56086648-56086670 CACTGCATTGGCAACACAGTTGG + Intergenic
1158651900 18:59295902-59295924 GATAGCAATGGGAACAAAGTGGG - Exonic
1159086845 18:63802242-63802264 CAGTGCAATGGGGAGACGGTGGG + Intronic
1159578392 18:70206899-70206921 AATAGGAATGGGAATACAGTAGG - Intergenic
1162832588 19:13295754-13295776 CAATGCACTGGGATTACAGGTGG + Intronic
1164647751 19:29872273-29872295 AACTGCAATGTGCATACAGTAGG + Intergenic
1165766497 19:38354756-38354778 CATTGCTATGGAAATACACAGGG - Exonic
1166610438 19:44188831-44188853 CATTTCAATGGGAATACAGTGGG + Intergenic
1166610920 19:44195481-44195503 TATTGCAATGGGAATATAGTGGG + Intergenic
1167642601 19:50689712-50689734 GGTTGCAGTGGGAATCCAGTGGG + Intronic
925721202 2:6829403-6829425 CAATGGAATGGGAATACCTTTGG - Intergenic
926848126 2:17164698-17164720 CAGTGCAATGGAATTACAGGAGG - Intergenic
929340612 2:40812126-40812148 CATTGCTATGGCACTTCAGTGGG + Intergenic
932099163 2:68880806-68880828 CATGGCAGAGAGAATACAGTTGG + Intergenic
933178104 2:79198974-79198996 CATTGCAATGAGTATACAAATGG + Intronic
933759390 2:85663567-85663589 CATTGCAGTGGGACCACAGAGGG + Intronic
934740023 2:96713544-96713566 CCTTGCTATAGAAATACAGTAGG - Intronic
937782104 2:125850336-125850358 CATTTGAATGGGAATACAGTAGG - Intergenic
939022149 2:136970831-136970853 CAAAGCAATGGGAATAAAGATGG + Intronic
939850262 2:147296000-147296022 CATTGCACTGAGAATAGGGTTGG + Intergenic
941454363 2:165697560-165697582 AATGGCTATGGGAATACAGAGGG + Intergenic
945517446 2:210779921-210779943 CATTGCATTGGGAGTTTAGTAGG + Intergenic
945637659 2:212376568-212376590 CATTTCAATGGGAAATCATTAGG + Intronic
946068431 2:217010243-217010265 CATGGGAATGGGAATACTGGAGG - Intergenic
946460080 2:219861206-219861228 CATTGCATTGGGAAAGAAGTTGG + Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
947355568 2:229291507-229291529 CATTTCAATGGGAAGTCACTAGG + Intergenic
1172885608 20:38228896-38228918 CATTGCACTGAGCTTACAGTGGG + Intronic
1173787547 20:45805395-45805417 CATTGCATTGGGAGTAGACTGGG + Intronic
1176891104 21:14320573-14320595 CACTACAATGGGAGTGCAGTAGG + Intergenic
1178385561 21:32146250-32146272 CAGTGTAATGGGAATATAGAAGG - Intergenic
1181594444 22:23905264-23905286 CCATGCAATGGGCATACAGAGGG + Intergenic
1182005403 22:26955523-26955545 CATGGCAATGGGAACAAAATGGG - Intergenic
1182856354 22:33520868-33520890 CAGTGCAATGAAAATACAGCTGG - Intronic
1183349619 22:37327606-37327628 CATTGGACTGGGAATAAAGAAGG - Intergenic
1184013743 22:41769791-41769813 CATTGTTATGGGAATGCAATGGG + Intronic
949100467 3:138220-138242 CATTGCAATAGGAATACGCATGG + Intergenic
949897224 3:8776978-8777000 CATTCCAATGGGCACAGAGTAGG - Intronic
953377079 3:42437730-42437752 CAAAGCACTGGGAATAGAGTGGG - Intergenic
953515610 3:43588397-43588419 CATTGAAATGGGAAAAAAGATGG + Intronic
953854307 3:46489167-46489189 CAGTGACATGGGCATACAGTGGG - Intergenic
956201849 3:66714571-66714593 CACTCCAATGGGAATACTGGCGG + Intergenic
956259701 3:67325434-67325456 CTTAACAATGGGTATACAGTCGG - Intergenic
957587486 3:82150666-82150688 CATTGTAAAGAGAATACAGTAGG - Intergenic
958946266 3:100365623-100365645 CATCGCAAAGTGAATACAGATGG + Exonic
958995161 3:100895630-100895652 CATTGCAATCTGAATGCACTTGG - Intronic
960073231 3:113455091-113455113 AATTGCAATGGGAATATGGTGGG - Intronic
961389864 3:126546069-126546091 CTTGCCACTGGGAATACAGTGGG - Intronic
965465697 3:169028229-169028251 CATTGCAATAAGAATAAAGAAGG + Intergenic
969125205 4:4942590-4942612 AATAACAATAGGAATACAGTTGG + Intergenic
969994714 4:11299965-11299987 CATTGCCATGGGCAGACAGATGG - Intergenic
971001904 4:22332708-22332730 CATTGGAGAGGGGATACAGTTGG - Intergenic
971886192 4:32451420-32451442 TATTGTAATGGGAAAACAATAGG - Intergenic
974359526 4:60858763-60858785 TTTTGCAATGATAATACAGTAGG + Intergenic
974374189 4:61055703-61055725 CAATGCATTTGCAATACAGTTGG + Intergenic
975916729 4:79333918-79333940 CATTGCAATGGGAATACAAGTGG - Intergenic
977867617 4:102048714-102048736 ACTTTCAATGGGAAAACAGTTGG - Intronic
982349004 4:154394308-154394330 CAGTGCAAAGGGATTACAGCTGG + Intronic
983816227 4:172129985-172130007 CACTGCAATGGGAATACACACGG + Intronic
986109683 5:4700441-4700463 CATTGCAGTGGGAAATGAGTTGG - Intergenic
987154033 5:15069948-15069970 CATTGCAATGAGAATACATGTGG + Intergenic
987947588 5:24631714-24631736 CAATGAAATGGAAATATAGTAGG - Intronic
988322785 5:29721478-29721500 AATAGCAATGGGAAGAGAGTTGG - Intergenic
988658770 5:33241421-33241443 GATTGCAAAGGGAAAACTGTGGG + Intergenic
988921556 5:35947030-35947052 CATTCCAGTGGGAATACACATGG + Intergenic
989080062 5:37608930-37608952 CTTTGCTCTGGGAATACAGCAGG - Intronic
991292400 5:65045465-65045487 GATTGCAATGAGAAGAGAGTTGG - Intergenic
995042023 5:107599785-107599807 CCTAGCAATGGCACTACAGTAGG - Intronic
995843583 5:116468376-116468398 CATTCCAATGAAAAGACAGTGGG - Intronic
1002492633 5:179589955-179589977 AAGAGCAATGGGAATACAGGAGG - Intronic
1002549826 5:179979349-179979371 CAAGGCAATGGGAATAAAATGGG + Intronic
1006293175 6:33156525-33156547 CATTGCCATGGGAGTATTGTGGG - Intergenic
1009312804 6:62176561-62176583 CATTTCAATGGGTAAACAGAGGG - Intronic
1013336679 6:109170152-109170174 CATTACAATGGGATTATATTTGG - Intergenic
1017233843 6:152099449-152099471 CATTGCCATAGGAATACAAGAGG - Exonic
1017440754 6:154462519-154462541 CAGTGCAGTGGGAAGCCAGTAGG - Intronic
1018537439 6:164836386-164836408 CATTGCAATGGGAATACAATGGG - Intergenic
1018799783 6:167212971-167212993 CATTGCAATGCGAAAGCAGCTGG + Intergenic
1018801377 6:167225169-167225191 CAGGACAATGGGAATGCAGTTGG - Intergenic
1020709286 7:11586021-11586043 CAATGCACTGTAAATACAGTGGG - Intronic
1021222406 7:17989264-17989286 CGGTGCAATGGGAACACACTAGG + Intergenic
1021420160 7:20437843-20437865 CATTGCATTAGGACTGCAGTGGG - Intergenic
1022645187 7:32223205-32223227 AAGTGAAATGGGAATACATTTGG - Intronic
1023228611 7:37999820-37999842 GAGTTCAATGGGAAGACAGTGGG + Intronic
1023476715 7:40587601-40587623 CATTGCCATGGCAAAGCAGTTGG + Intronic
1030372382 7:108715012-108715034 TACTGCAATGGGAAAACACTGGG + Intergenic
1032513538 7:132490871-132490893 GATTCCACTGGAAATACAGTGGG - Intronic
1037868011 8:22463298-22463320 CATTGCCATGGACAAACAGTGGG - Intronic
1038325413 8:26569093-26569115 CAAAGCAGTGGGATTACAGTTGG - Intronic
1039311957 8:36326312-36326334 CATTGAAATAACAATACAGTTGG + Intergenic
1041925095 8:63228381-63228403 CATTCCATTGAGGATACAGTGGG + Intergenic
1048385573 8:133909498-133909520 TATTGCAATGGGAATTTATTGGG - Intergenic
1049756435 8:144313160-144313182 CGTTGCACTGGGAAAACAGGTGG - Intronic
1049921510 9:369200-369222 CCTTGCATTGGGAAGACAGGTGG - Intronic
1050833584 9:10047680-10047702 CACTGCAATAGGAAAACACTGGG + Intronic
1051037436 9:12765415-12765437 AAGTGCAATGGTAATACTGTGGG + Intergenic
1053014673 9:34655034-34655056 CAAAGCACTGGGTATACAGTGGG + Intronic
1057447927 9:95131454-95131476 CCTTGCAATGGAATTGCAGTTGG - Intronic
1057821538 9:98335069-98335091 CATTGCAATGGGAAGACAGAGGG - Intronic
1059477853 9:114562181-114562203 CATTGCAATGGGAGTACAGGTGG + Intergenic
1060007193 9:120010998-120011020 CATTCCGATGGGAATACATGTGG + Intergenic
1185832326 X:3314124-3314146 CATTGCACTGTGAATTTAGTTGG + Intronic
1186225355 X:7393463-7393485 CATTAAAATTGGAACACAGTTGG - Intergenic
1187827883 X:23350962-23350984 CATTTTCATGGGAATCCAGTAGG - Intronic
1188493071 X:30756245-30756267 CACTGCAATGGTGATACAGTAGG - Intergenic
1189634070 X:42986291-42986313 CATTGGAATGGAAATAAAATGGG - Intergenic
1190413651 X:50161495-50161517 GATTGCTATAGGAATCCAGTTGG - Intergenic
1190584681 X:51927289-51927311 AATTGCAATGGGAAGGCAATAGG + Intergenic
1191710463 X:64144743-64144765 CTTTGCAGTGAGAATTCAGTAGG - Intergenic
1194412402 X:93573128-93573150 AATTGCAATGGTAATACAAAGGG - Intergenic
1196584095 X:117409414-117409436 AACTGCAATGGCAGTACAGTAGG - Intergenic
1197604709 X:128571854-128571876 AAATGCAATGGAAATAGAGTTGG - Intergenic
1199322306 X:146455205-146455227 CATTGAGAAGGGAAGACAGTGGG + Intergenic