ID: 1107694335

View in Genome Browser
Species Human (GRCh38)
Location 13:42985881-42985903
Sequence GTTTTTAAGGGGATTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107694335_1107694347 13 Left 1107694335 13:42985881-42985903 CCTCCATGAATCCCCTTAAAAAC 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1107694347 13:42985917-42985939 CCATGGAAGAAACAAACTTGAGG 0: 1
1: 1
2: 1
3: 20
4: 236
1107694335_1107694340 -4 Left 1107694335 13:42985881-42985903 CCTCCATGAATCCCCTTAAAAAC 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1107694340 13:42985900-42985922 AAACCCTTGCCCAGAACCCATGG 0: 1
1: 0
2: 1
3: 24
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107694335 Original CRISPR GTTTTTAAGGGGATTCATGG AGG (reversed) Intronic
900872280 1:5312534-5312556 GTTTTTAAGGTGATTCTTAGAGG - Intergenic
901678279 1:10899212-10899234 GTTTTTACGAAGAGTCATGGTGG - Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
901969072 1:12893153-12893175 GTCTTTCAGAGCATTCATGGAGG + Exonic
902016099 1:13308628-13308650 GTCTTTCAGAGCATTCATGGAGG - Intronic
904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG + Intronic
905092265 1:35439038-35439060 CTTTTTAAGGGGATGAATGGTGG - Intronic
906999271 1:50833504-50833526 GTTGTTTAGGGGTTTTATGGAGG + Intronic
908896994 1:68911840-68911862 GGTTTTAAGGGGATTTATGGAGG - Intergenic
910671888 1:89781997-89782019 GTATTTAGGGGGTTTTATGGAGG + Intronic
911798734 1:102107662-102107684 GTTTTTAAGGTGATTGTTGTAGG + Intergenic
912243148 1:107932859-107932881 TTTTTTAAGAGGCTTCAAGGAGG - Intronic
913054667 1:115147048-115147070 CTTTTTAACGGGATTATTGGGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914989355 1:152485067-152485089 TTCTTTAAGGGGGATCATGGGGG + Intergenic
915292525 1:154896272-154896294 GTTATTTAGGAGTTTCATGGTGG - Intergenic
916179607 1:162071905-162071927 GTTTTTAAGGCTAAGCATGGTGG + Intronic
917898923 1:179521345-179521367 GTTTTTCAGTGGATTCTTTGGGG + Intronic
918169918 1:181986869-181986891 GTTAGAAAGGGGATTCATAGAGG - Intergenic
918635370 1:186767859-186767881 TTTTTTAAGAAGATTCATGATGG - Intergenic
920157411 1:203965703-203965725 GTGTTTTAGGAGATTCATGAAGG - Intergenic
921218308 1:212955234-212955256 GTTTTCAAGGGCCTGCATGGAGG + Intronic
921711983 1:218381998-218382020 AATTTTAAGGGGATTCCTGCAGG + Intronic
921891098 1:220354526-220354548 GTTTTTAAAGTGAATGATGGTGG + Intergenic
923121425 1:230995697-230995719 GTTTTTAAGGGGATATATTTTGG + Intronic
923426232 1:233872637-233872659 GTTTTCAAGGGGAAACAAGGGGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924788115 1:247219305-247219327 TTTTTTGAGGGGGATCATGGGGG - Intergenic
924804994 1:247354983-247355005 TTTTTTGAGGGGGATCATGGGGG - Intergenic
1063870360 10:10410231-10410253 ATTTTTAAATGGATTTATGGTGG - Intergenic
1064984630 10:21197921-21197943 GTTTCTTAAGGGAATCATGGAGG - Intergenic
1065746264 10:28845299-28845321 GTTTTCAAGGGGATTATGGGGGG + Intergenic
1066053629 10:31660360-31660382 GTTTTGAAGTGTATTCATGCTGG - Intergenic
1068069135 10:52173443-52173465 CTTTCTAAAAGGATTCATGGGGG - Intronic
1071676018 10:87657020-87657042 GTTTTTCAGGGAAGTCTTGGAGG + Intergenic
1072794668 10:98345436-98345458 GTTTTTGAGGGGATGAATGGTGG + Intergenic
1074378184 10:112956093-112956115 ATTTTTAATGTGATTCAGGGGGG - Intronic
1074895353 10:117772737-117772759 CTTTCTATGAGGATTCATGGGGG + Intergenic
1075822692 10:125328339-125328361 ATTTATAAAGGGATTTATGGGGG - Intergenic
1080333949 11:31174687-31174709 GTTTTTAATGGGCTTCAGAGGGG - Intronic
1080893787 11:36432192-36432214 GTTTTTAATGGGATGCAGGCTGG + Intronic
1082961831 11:58925355-58925377 GTTATAAAAGGGATTCATGCAGG - Intronic
1082974113 11:59055310-59055332 ATTTTTAAAGGGAATCATTGGGG + Intergenic
1082978526 11:59099101-59099123 ATTTTTAAAGGGAATCATTGGGG + Intergenic
1087123913 11:94604389-94604411 ATATTTCAGGGGATTCTTGGAGG + Intronic
1087724921 11:101705902-101705924 TTTTATAAGGGGAATCCTGGGGG - Intronic
1088629287 11:111758712-111758734 GTTTGAAAGGGAATCCATGGAGG + Intronic
1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG + Intergenic
1091129892 11:133136886-133136908 GGTTTTAATGTGTTTCATGGGGG + Intronic
1092733762 12:11559390-11559412 CTGTTTAATGGGGTTCATGGAGG - Intergenic
1093137128 12:15465761-15465783 CTATTTAATGGGGTTCATGGAGG + Intronic
1094024609 12:25949604-25949626 GTTTTAAAGAGGATGCCTGGAGG + Intergenic
1096037779 12:48487988-48488010 CTTTTTAAGGAGAGTCATGGTGG + Intronic
1096175121 12:49509967-49509989 GGTTTTAAGGCCATTTATGGTGG + Intronic
1096491939 12:52017542-52017564 GATTCTAGAGGGATTCATGGAGG - Intergenic
1097238928 12:57560712-57560734 GTTTTTAAGGCGGGGCATGGTGG + Intronic
1097697808 12:62791366-62791388 GTTTTTATGGGTTTTCTTGGAGG - Intronic
1107694335 13:42985881-42985903 GTTTTTAAGGGGATTCATGGAGG - Intronic
1110048200 13:70858841-70858863 GTTCTGAAGGGGAATCATAGTGG - Intergenic
1111595378 13:90404121-90404143 GTTTTTAATGGGCTTCAGAGGGG - Intergenic
1111989995 13:95106958-95106980 GTTTTTAAGAGTATTCAGGCTGG + Intronic
1112590081 13:100754911-100754933 GTTTTAAATGGGATTGATGAAGG - Intergenic
1112759716 13:102680591-102680613 TTTCTTAAGGAGATTCATGGGGG - Intergenic
1113169725 13:107486824-107486846 TTTTTTAACATGATTCATGGAGG + Intronic
1113556951 13:111244508-111244530 ATTTTTAAGGTGTTCCATGGAGG + Intronic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1114980489 14:28158041-28158063 GTTTTTAATGGGCTTCAGAGGGG + Intergenic
1115920930 14:38372588-38372610 GTTTTCAAAGAGATTCATTGTGG - Intergenic
1118809959 14:69265967-69265989 GTTGTTGAGGGGATTCAGAGAGG - Intronic
1120600978 14:86508807-86508829 TTTTTTAAGGGCATTTATGGAGG - Intergenic
1124357821 15:29010086-29010108 GATTTTTAGTGGATGCATGGTGG + Intronic
1124658851 15:31528928-31528950 GTTGTACAGGGGATTCTTGGAGG + Intronic
1126731728 15:51690320-51690342 GTTTTAAAGAGAATTCAAGGTGG - Intronic
1127638841 15:60896416-60896438 GTTTTTAAAGGGTCTAATGGAGG - Intronic
1129652045 15:77497897-77497919 GTTTTTAGGGGGTTGCTTGGCGG - Intergenic
1129810808 15:78508116-78508138 GCTTTTAAGGGTCTTCCTGGTGG - Intronic
1130963937 15:88683426-88683448 GTTTTTACTGTGTTTCATGGAGG - Intergenic
1132791518 16:1692070-1692092 GTTTTTAGGGAGAATCATGGTGG + Intronic
1133498415 16:6342130-6342152 GCTTTGAAGGGGAGTGATGGTGG + Intronic
1133810948 16:9160633-9160655 GTTTATAGAGGGATTCATGGGGG + Intergenic
1133903067 16:9995342-9995364 ATTTTTAAGCAGGTTCATGGAGG + Intronic
1135553534 16:23416818-23416840 GTTGTTAAGGATATTCATAGTGG - Intronic
1135967318 16:27046852-27046874 TTTTTTAGGGGGATCCATGTGGG - Intergenic
1136122389 16:28147171-28147193 GTTTACAAGGGCATACATGGAGG + Intronic
1138358449 16:56405477-56405499 GATTGTAGGGGGATTCCTGGGGG - Intronic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1148597325 17:48867128-48867150 GTTTTTAGGGCCAGTCATGGTGG + Intergenic
1150821486 17:68437788-68437810 ATTTATAAGGGGATTCAAGAAGG + Intronic
1150995579 17:70313948-70313970 GTTTTTAAATGAATTCATTGAGG - Intergenic
1157992137 18:52510102-52510124 TTTTTGAAGGGGATGCAGGGGGG - Intronic
1158302054 18:56063392-56063414 GTTTCTAATGGGAAGCATGGGGG - Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159624130 18:70671993-70672015 GTTATTTATGGAATTCATGGTGG - Intergenic
1159948620 18:74462071-74462093 GTTTTTAAGCAGATTTATTGAGG + Intergenic
1161763102 19:6188740-6188762 GGTTTTAAGGGGATCTTTGGGGG + Intronic
1168607686 19:57772767-57772789 GTCTTTATGGGGTTTTATGGAGG + Intronic
929314910 2:40465276-40465298 GTTTTACAGGGCATTCATGTAGG + Intronic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
936170009 2:110162518-110162540 ATTTTAAAGAGGATTCATGCTGG - Intronic
936181010 2:110267567-110267589 ATATTTGAGGGGCTTCATGGAGG - Intergenic
936200361 2:110401862-110401884 ATATTTGAGGGGCTTCATGGAGG + Intergenic
943294298 2:186117377-186117399 ATTTTTAAGGGGATTTGTGGAGG - Intergenic
943858436 2:192828511-192828533 GTTTTTATGGGGGTTCAGAGGGG - Intergenic
943955132 2:194178565-194178587 GTTTTTAAGAGGATTATTGTGGG + Intergenic
945731688 2:213545168-213545190 GTGTTTAATGGTATTCATTGTGG + Intronic
946235280 2:218320963-218320985 GTGTTTTAGGGGAGTCATGCAGG - Intronic
947987057 2:234457670-234457692 GTTTTTAAAGGGTTTAAAGGCGG - Intergenic
1169902472 20:10567371-10567393 GTTTTAAAAGGGCTTGATGGAGG + Intronic
1171312810 20:24159320-24159342 GTTTTTAAGGGGATGCCTCAAGG + Intergenic
1172798168 20:37557693-37557715 GTTTTTAAGGCCAGGCATGGTGG + Intergenic
1173419185 20:42885742-42885764 GTTTTTACCGTGAATCATGGGGG - Intronic
1173972615 20:47164329-47164351 ATTTGTAAGGGGATTGTTGGGGG - Intronic
1174390201 20:50214319-50214341 AGTTTTAATGGGATTCCTGGTGG + Intergenic
1175124609 20:56741953-56741975 GTCTTTATGGGGATTGAGGGTGG + Intergenic
1177815253 21:25969550-25969572 GATTTAAAGGTGAGTCATGGTGG + Intronic
1181453839 22:23042741-23042763 GTCTTTAAGGAGTTTCATGAAGG - Intergenic
1181791377 22:25269571-25269593 GTTTTTTACGGGGATCATGGAGG + Intergenic
1181827071 22:25525682-25525704 GTTTTTTAAGGGGATCATGGAGG + Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1184219648 22:43091324-43091346 GTTCTTGTGGGGATTCATTGAGG - Intergenic
1184285585 22:43469323-43469345 GATTTTCAGGGGCTTTATGGGGG - Intronic
949122824 3:407727-407749 GTTTTTAAAGAGAGTCATGCAGG + Exonic
949193528 3:1278713-1278735 GTTTTTAAGGAGATACATCATGG + Intronic
949606210 3:5657092-5657114 GTTTTTAAAGGGGATCATGGAGG + Intergenic
950152291 3:10697120-10697142 GTTTGTAATAGGATTCAGGGTGG - Intronic
950880444 3:16318731-16318753 GTTTTTTGGGGGATACAGGGTGG - Intronic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
958600703 3:96293266-96293288 GTTTTTAATGGGATTTGTGAAGG + Intergenic
964670983 3:159226117-159226139 ATTTTTTAGGGGCTTTATGGTGG + Intronic
965366889 3:167812209-167812231 GTTTTTAAGGCGATTAATCTTGG - Intronic
965408090 3:168295449-168295471 GTTTTTAAGTGTTTTCTTGGAGG + Intergenic
965561556 3:170066700-170066722 GTTTATAAGAGTATTCATGGAGG - Intronic
965782653 3:172304181-172304203 ATTTTTAGTGGGATTCTTGGAGG - Intronic
966121137 3:176521892-176521914 GCTTTTAAGGGGATTTGTGGAGG + Intergenic
970262818 4:14246701-14246723 CTTCTTAAGGGGAATGATGGTGG + Intergenic
971272333 4:25161567-25161589 TTTTTTAAGGGGATTTGTGGAGG - Intronic
973534512 4:51867661-51867683 GTTTTTAATGGGTTTCAGAGGGG + Intronic
974046638 4:56904178-56904200 GTTATTAGGGAGATTCAAGGAGG + Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
976157758 4:82166099-82166121 GTTTTTAATGGGATTATTTGTGG - Intergenic
977301858 4:95276592-95276614 GTTTTAAGGTGGTTTCATGGAGG + Intronic
977429278 4:96911379-96911401 TCATTTAATGGGATTCATGGTGG + Intergenic
978456516 4:108898594-108898616 GTTTTTATGGGAATTCTTTGTGG + Intronic
980054077 4:128062752-128062774 GTTTTTAAAGTGCTTTATGGGGG + Intronic
980945586 4:139317297-139317319 GTTTTTATGAGGATTTGTGGAGG + Intronic
984135662 4:175934893-175934915 GTTTTTAAGGATATACATGCTGG - Intronic
985037876 4:185859589-185859611 ATATTTATGGGGAATCATGGGGG - Intronic
987351866 5:17029537-17029559 CTTTTTAATGGGATTGTTGGGGG - Intergenic
989315202 5:40070366-40070388 TCCTTTAAGGGGCTTCATGGAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
990670360 5:58122543-58122565 TTATTTATGGGGATTCATGCTGG + Intergenic
990766619 5:59190912-59190934 TTTTTTAAGGGGCTTCATCATGG - Intronic
991352482 5:65733396-65733418 GTCTTTCAGAGCATTCATGGAGG - Intronic
993167326 5:84373989-84374011 GTTTTTAAGGGGACGAATGATGG + Intronic
994078069 5:95675778-95675800 GAATTCAAGGGGTTTCATGGGGG - Intronic
994403058 5:99306676-99306698 GTTATTTAAGGGATTCATGGGGG + Intergenic
994552472 5:101255186-101255208 TTTTTTGAGGGGTTTTATGGAGG - Intergenic
995026559 5:107430371-107430393 GATTTTAAAGAGATTCAAGGGGG + Intronic
998291712 5:140922135-140922157 GTTTTTGATGAGTTTCATGGAGG - Intronic
1001347095 5:170913608-170913630 GTTTTTGAGAGGATTGATTGTGG + Intronic
1006463783 6:34178982-34179004 GTTTTTAATGGGCTTCAGAGGGG + Intergenic
1007483734 6:42166656-42166678 GTTTCTAAGGGCGTCCATGGAGG - Intronic
1007826561 6:44605376-44605398 GCATTTAAGAGGATTCATGTGGG + Intergenic
1010089864 6:71968018-71968040 GTTCTTAAGAGCTTTCATGGAGG - Intronic
1010744352 6:79544029-79544051 GTTTGAAAGAGGATTCTTGGGGG - Intergenic
1011552007 6:88538501-88538523 CCTTTGAAGGGGATGCATGGTGG + Intergenic
1014843469 6:126246780-126246802 TATTTTAATGGGATTTATGGAGG - Intergenic
1015054776 6:128887234-128887256 AATTTTCAGGGGATTCATAGTGG + Intronic
1016491882 6:144614211-144614233 GTGTTGAATGAGATTCATGGTGG + Intronic
1017248929 6:152259150-152259172 GATTTTAAGGGGATGCTGGGTGG - Intronic
1017644140 6:156523571-156523593 GAATGTAAGAGGATTCATGGAGG + Intergenic
1018557035 6:165060663-165060685 GGTGTTGAGGGGAATCATGGAGG - Intergenic
1022850666 7:34258557-34258579 TTGTTTAAGGGGCTTTATGGAGG + Intergenic
1023111567 7:36817908-36817930 GTTTTTAAATGGATTCTTTGGGG - Intergenic
1023766095 7:43512101-43512123 GTTCATCAGGAGATTCATGGAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027226331 7:76246195-76246217 GATTGTCAGAGGATTCATGGAGG - Intronic
1029026666 7:97423955-97423977 CTTTCTAGGGGGATTTATGGAGG + Intergenic
1030545685 7:110892339-110892361 GTTTTTATGGGAATTCAATGGGG - Intronic
1032988025 7:137360663-137360685 GTGTCTAATGGGAGTCATGGGGG + Intergenic
1033712683 7:143964973-143964995 ATTTTTTAGGGGTTTCAAGGTGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1036583455 8:10100170-10100192 GTTATTGAGGGGCTGCATGGGGG + Intronic
1038525880 8:28272884-28272906 GGTTTTTAGGGGGATCATGGAGG + Intergenic
1038881611 8:31619666-31619688 GTTTTTAAGGAGCTTCACAGGGG + Intergenic
1038991493 8:32873081-32873103 TTTTTTAAGGGGACTGAAGGGGG + Intergenic
1039242193 8:35569244-35569266 GGTTTTATGGGGATCCATGGAGG - Intronic
1042290353 8:67164668-67164690 GTTCTCAAGGGGATTCATGTAGG + Intronic
1043040428 8:75255505-75255527 GTTTTTAATGGGATTATTTGTGG - Intergenic
1044823301 8:96173454-96173476 GTATTTCTGGGGATTCTTGGAGG + Intergenic
1046734226 8:117759151-117759173 TTTTATAAGTGGATACATGGAGG + Intergenic
1051416998 9:16852573-16852595 GTTCTTATGGGGCTTCATGGTGG + Intronic
1052178606 9:25497287-25497309 GTTTTTATGGAGATTTCTGGTGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055702795 9:78964215-78964237 GTTGTTGAGGGGATTAATGGAGG - Intergenic
1056606848 9:88093025-88093047 GTTTTTAAGGGGATTTGTGGAGG - Intergenic
1057287696 9:93773487-93773509 GATTTTAAAGGGGATCATGGAGG + Intergenic
1058956832 9:109956888-109956910 TTTTTTAAGAGGATGCAAGGAGG - Intronic
1061050591 9:128192451-128192473 GTTGTTAAGGGGGTTCTTGGGGG - Intronic
1185702354 X:2240678-2240700 GTTTTGAAGGTGAATCGTGGCGG + Intronic
1185809148 X:3088894-3088916 ATTTTTTAGGGGAATCATGGAGG + Intronic
1186263671 X:7808629-7808651 GCTTTTAACTGGATTCCTGGGGG - Intergenic
1189187311 X:39065468-39065490 CTTTTTAAGGAGTTTCATGCTGG - Intergenic
1193047619 X:77069238-77069260 CTTTTTAAGGGGGAACATGGGGG - Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195825913 X:109000514-109000536 ATTTTTAAAGGGATTCTAGGTGG - Intergenic
1197162792 X:123342886-123342908 TTTTTTAATTGAATTCATGGTGG + Intronic
1200013601 X:153140574-153140596 GTTTTTTGGGGGCTTAATGGAGG + Intergenic
1200026000 X:153259344-153259366 GTTTTTTGGGGGCTTAATGGAGG - Intergenic
1201453794 Y:14145943-14145965 TTTTTTAACTGGATTCCTGGGGG + Intergenic
1201453806 Y:14146053-14146075 GCTTTTAACTGGATTCCTGGGGG + Intergenic