ID: 1107695969

View in Genome Browser
Species Human (GRCh38)
Location 13:43000308-43000330
Sequence CTGAAAAAACAAAGTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107695967_1107695969 24 Left 1107695967 13:43000261-43000283 CCAACATAGTATATTCAATAAAT No data
Right 1107695969 13:43000308-43000330 CTGAAAAAACAAAGTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107695969 Original CRISPR CTGAAAAAACAAAGTGAGCA GGG Intergenic
No off target data available for this crispr