ID: 1107697621

View in Genome Browser
Species Human (GRCh38)
Location 13:43015850-43015872
Sequence CAGTGGAAGGAGAGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107697621_1107697628 -4 Left 1107697621 13:43015850-43015872 CCTCCTCCCCTCTCCTTCCACTG No data
Right 1107697628 13:43015869-43015891 ACTGTCCATTCCTTGAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107697621 Original CRISPR CAGTGGAAGGAGAGGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr