ID: 1107699249

View in Genome Browser
Species Human (GRCh38)
Location 13:43031482-43031504
Sequence CTAGGCTTGTCCTCTTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107699249_1107699256 23 Left 1107699249 13:43031482-43031504 CCTGTAGAAGAGGACAAGCCTAG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1107699256 13:43031528-43031550 GTACTTTGGGAGTGTAGAGGAGG 0: 1
1: 1
2: 3
3: 33
4: 478
1107699249_1107699252 -2 Left 1107699249 13:43031482-43031504 CCTGTAGAAGAGGACAAGCCTAG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1107699252 13:43031503-43031525 AGTTGAAAATGCGTTACAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 125
1107699249_1107699251 -3 Left 1107699249 13:43031482-43031504 CCTGTAGAAGAGGACAAGCCTAG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1107699251 13:43031502-43031524 TAGTTGAAAATGCGTTACAGTGG 0: 1
1: 0
2: 0
3: 6
4: 92
1107699249_1107699255 20 Left 1107699249 13:43031482-43031504 CCTGTAGAAGAGGACAAGCCTAG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1107699255 13:43031525-43031547 GCAGTACTTTGGGAGTGTAGAGG 0: 1
1: 1
2: 1
3: 10
4: 218
1107699249_1107699254 10 Left 1107699249 13:43031482-43031504 CCTGTAGAAGAGGACAAGCCTAG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1107699254 13:43031515-43031537 GTTACAGTGGGCAGTACTTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
1107699249_1107699253 9 Left 1107699249 13:43031482-43031504 CCTGTAGAAGAGGACAAGCCTAG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1107699253 13:43031514-43031536 CGTTACAGTGGGCAGTACTTTGG 0: 1
1: 0
2: 0
3: 1
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107699249 Original CRISPR CTAGGCTTGTCCTCTTCTAC AGG (reversed) Intronic