ID: 1107708344

View in Genome Browser
Species Human (GRCh38)
Location 13:43128794-43128816
Sequence GATGGTGGGCGCGTGTGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107708344_1107708353 29 Left 1107708344 13:43128794-43128816 CCGCTGCACACGCGCCCACCATC No data
Right 1107708353 13:43128846-43128868 ACGTTCTCGGACTCAGGCCATGG No data
1107708344_1107708351 16 Left 1107708344 13:43128794-43128816 CCGCTGCACACGCGCCCACCATC No data
Right 1107708351 13:43128833-43128855 CAGAGATTTAATCACGTTCTCGG No data
1107708344_1107708352 23 Left 1107708344 13:43128794-43128816 CCGCTGCACACGCGCCCACCATC No data
Right 1107708352 13:43128840-43128862 TTAATCACGTTCTCGGACTCAGG No data
1107708344_1107708347 -9 Left 1107708344 13:43128794-43128816 CCGCTGCACACGCGCCCACCATC No data
Right 1107708347 13:43128808-43128830 CCCACCATCTCCAGGCTGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107708344 Original CRISPR GATGGTGGGCGCGTGTGCAG CGG (reversed) Intergenic