ID: 1107708887

View in Genome Browser
Species Human (GRCh38)
Location 13:43133253-43133275
Sequence CTGTTTCTCCAGCAGACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107708887_1107708890 -10 Left 1107708887 13:43133253-43133275 CCCCATGTCTGCTGGAGAAACAG No data
Right 1107708890 13:43133266-43133288 GGAGAAACAGCCACAGCCCTTGG No data
1107708887_1107708894 11 Left 1107708887 13:43133253-43133275 CCCCATGTCTGCTGGAGAAACAG No data
Right 1107708894 13:43133287-43133309 GGCACCTTCCACCCCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107708887 Original CRISPR CTGTTTCTCCAGCAGACATG GGG (reversed) Intergenic
No off target data available for this crispr