ID: 1107710102

View in Genome Browser
Species Human (GRCh38)
Location 13:43142939-43142961
Sequence CTGAAGGCAGAGATGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107710096_1107710102 3 Left 1107710096 13:43142913-43142935 CCAGAACCAAAGAAAGCCACAGG No data
Right 1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG No data
1107710093_1107710102 30 Left 1107710093 13:43142886-43142908 CCAGGAGAGCTCCAAGTGATGAT No data
Right 1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG No data
1107710098_1107710102 -3 Left 1107710098 13:43142919-43142941 CCAAAGAAAGCCACAGGATGCTG No data
Right 1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG No data
1107710095_1107710102 19 Left 1107710095 13:43142897-43142919 CCAAGTGATGATGAGGCCAGAAC No data
Right 1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107710102 Original CRISPR CTGAAGGCAGAGATGTAGGA AGG Intergenic
No off target data available for this crispr