ID: 1107711718

View in Genome Browser
Species Human (GRCh38)
Location 13:43157111-43157133
Sequence AGATATCTACAGATGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107711718_1107711729 14 Left 1107711718 13:43157111-43157133 CCACCCACCATCTGTAGATATCT No data
Right 1107711729 13:43157148-43157170 CCACTGTGGGTGGAATGCTGTGG No data
1107711718_1107711725 4 Left 1107711718 13:43157111-43157133 CCACCCACCATCTGTAGATATCT No data
Right 1107711725 13:43157138-43157160 TCTCCCACAGCCACTGTGGGTGG No data
1107711718_1107711722 0 Left 1107711718 13:43157111-43157133 CCACCCACCATCTGTAGATATCT No data
Right 1107711722 13:43157134-43157156 TTCCTCTCCCACAGCCACTGTGG No data
1107711718_1107711723 1 Left 1107711718 13:43157111-43157133 CCACCCACCATCTGTAGATATCT No data
Right 1107711723 13:43157135-43157157 TCCTCTCCCACAGCCACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107711718 Original CRISPR AGATATCTACAGATGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr