ID: 1107721586

View in Genome Browser
Species Human (GRCh38)
Location 13:43253898-43253920
Sequence AGCCATACCTCTTGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107721582_1107721586 13 Left 1107721582 13:43253862-43253884 CCTGTTCCTTGTTGCTCAGGGTA 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1107721586 13:43253898-43253920 AGCCATACCTCTTGTGAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1107721584_1107721586 7 Left 1107721584 13:43253868-43253890 CCTTGTTGCTCAGGGTATCAGGC 0: 1
1: 0
2: 4
3: 17
4: 151
Right 1107721586 13:43253898-43253920 AGCCATACCTCTTGTGAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 96
1107721579_1107721586 16 Left 1107721579 13:43253859-43253881 CCTCCTGTTCCTTGTTGCTCAGG 0: 1
1: 0
2: 0
3: 20
4: 233
Right 1107721586 13:43253898-43253920 AGCCATACCTCTTGTGAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107721586 Original CRISPR AGCCATACCTCTTGTGAGGC AGG Intronic
903141731 1:21343264-21343286 AGCCAAACCCCATGTGAGGGAGG - Intronic
904386637 1:30146712-30146734 GGCGATTCCTCTTGGGAGGCAGG - Intergenic
906882733 1:49610154-49610176 AGCCATTCCTCATGTGAAGGAGG + Intronic
914515045 1:148367243-148367265 AGTAATACCTGTTGTGAGTCAGG + Intergenic
917514221 1:175693599-175693621 CCCCATCCCTCTTGTGAGTCAGG - Intronic
918175309 1:182038975-182038997 GGCCTTACCAATTGTGAGGCAGG + Intergenic
918809176 1:189093582-189093604 ATCCATACATCTTTTGAAGCTGG - Intergenic
1067096254 10:43302625-43302647 AGCCATACTTGTTTTGGGGCAGG + Intergenic
1070474863 10:76820326-76820348 AGCCAGACCACGTGTGAGGAGGG - Intergenic
1073448460 10:103594995-103595017 AGCCATACAACTTGAGAGACTGG + Exonic
1076088690 10:127659302-127659324 AGTCATTCCTCATGTGGGGCTGG - Intergenic
1079504308 11:21136273-21136295 AGCCATGCCTGTTGTGAGGGGGG + Intronic
1084149120 11:67279943-67279965 AGCCATACCCCTTCTGAGAGCGG - Intronic
1084712984 11:70855613-70855635 AGCGTTACCTCTTGTGAAGTTGG - Intronic
1085837634 11:79973638-79973660 ATGAATACCTCTTTTGAGGCAGG + Intergenic
1089814326 11:121158856-121158878 AGCCATATTTGTTGTGAGGATGG - Intronic
1090589699 11:128252037-128252059 GGCCATTCCTCTGGGGAGGCAGG - Intergenic
1092067947 12:5607672-5607694 AGCTCTGCCTCTTGTCAGGCCGG + Intronic
1094287541 12:28812313-28812335 TGGCAGACATCTTGTGAGGCAGG - Intergenic
1101228654 12:102715956-102715978 AGTCATACATCTTATAAGGCAGG - Intergenic
1102934882 12:116888012-116888034 AGCCCTATCTCTTGTGACTCCGG - Intergenic
1104492568 12:129207670-129207692 AGCCATACCTGCTGTAACGCTGG - Intronic
1106544338 13:30717215-30717237 AGCCAGACCTCTTTTTGGGCAGG + Intronic
1107721586 13:43253898-43253920 AGCCATACCTCTTGTGAGGCAGG + Intronic
1108816323 13:54295949-54295971 AACAATCCATCTTGTGAGGCTGG - Intergenic
1117064023 14:51990695-51990717 CCCCATACCTCTTTTGAGGTAGG - Intronic
1126554930 15:49976069-49976091 CGCCATACCTCTTTTGGGGAGGG - Intronic
1126701015 15:51367623-51367645 AGCCCTACCCCTTGAAAGGCAGG + Intronic
1127723046 15:61721512-61721534 GGCCCTACCTCTTGAGAGGGGGG - Intergenic
1129058854 15:72844252-72844274 ACCCATCCCTCTTTTGAGTCTGG + Intergenic
1133511436 16:6461546-6461568 AACCATAACACTTGTGTGGCTGG + Intronic
1142686158 17:1578058-1578080 GGCCATACCTCGTGGGAAGCAGG - Intronic
1143390128 17:6555468-6555490 GGCAGTGCCTCTTGTGAGGCTGG - Intronic
1149003183 17:51777983-51778005 AGCCTCATCTGTTGTGAGGCAGG + Intronic
1149094758 17:52827338-52827360 AGCCTTACCAGTTGTGAAGCCGG + Intergenic
1151928721 17:77217270-77217292 AGCTAAAGCTCTTCTGAGGCCGG - Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160480267 18:79233601-79233623 AGCCCCACCTCTCGTGAGGGTGG - Intronic
1160594741 18:79965267-79965289 AGCCAGTCCTCTTGTGGGCCTGG - Intronic
1164267210 19:23631075-23631097 AGCCACAGCTCTTGTGTGTCTGG - Intronic
1164696236 19:30246581-30246603 TGCCAGACCTCTTGTGGGGTGGG - Intronic
1166798665 19:45443194-45443216 AGCCATACCTCCTTGGAGCCTGG - Intronic
1168541169 19:57211647-57211669 AGCCATAACTCATGTGAGTCAGG + Exonic
926742150 2:16120919-16120941 AGACACTCCTCTTGAGAGGCAGG - Intergenic
931430618 2:62206082-62206104 ACCCATACCTCTTCTCAGCCTGG - Intronic
931958351 2:67453155-67453177 AGCCATATGTCTTCTGAGGGTGG + Intergenic
932933490 2:76073282-76073304 AGACATTCCTCTAATGAGGCAGG - Intergenic
942163674 2:173219481-173219503 AGTCAAACCTCATGTGAGGAAGG + Intronic
946187385 2:217988677-217988699 AGCCAGACCTCTTGGGAGGAGGG + Intronic
1170868379 20:20181464-20181486 AAGCAAACCTCTTGTGAAGCAGG + Intronic
1178495842 21:33085701-33085723 AGCCCTGCCTTTTGTGTGGCTGG - Intergenic
1181480612 22:23196773-23196795 AGCTCTACCTCCTGTCAGGCCGG - Intronic
1181630786 22:24150173-24150195 AGCTTTACTTTTTGTGAGGCTGG + Intronic
1185010232 22:48308839-48308861 AGCTTGCCCTCTTGTGAGGCAGG - Intergenic
950567698 3:13780810-13780832 AGCCAGGCCACTTGTGGGGCTGG + Intergenic
953462757 3:43094764-43094786 AGTCATATTTCTTGTGATGCTGG - Intronic
957955771 3:87185252-87185274 AGCCATTCCTCTTGTACAGCCGG - Intergenic
961436646 3:126923569-126923591 GGCCTTACCTCATTTGAGGCAGG + Intronic
963385199 3:144583720-144583742 GGCCTTAGCTATTGTGAGGCAGG - Intergenic
965008151 3:163053304-163053326 GGCCTTACCTATTGTGAAGCAGG + Intergenic
965262723 3:166504764-166504786 AGCCAGACCTGGTGTGAGGAGGG + Intergenic
971945793 4:33275395-33275417 AGCCAAACCTCTTGTGAAAATGG + Intergenic
973025292 4:45261331-45261353 TGCCATACCTCCTGTGAGAAGGG - Intergenic
974982228 4:68972821-68972843 AGCAATAGCTCTTGAGTGGCAGG + Intergenic
975003195 4:69252398-69252420 AGCAATAGCTCTTGAGAGGAAGG - Intergenic
977183340 4:93904751-93904773 ACTCATACCTGTTGCGAGGCTGG - Intergenic
978441695 4:108740195-108740217 AGACATACCACTTGTGAGTGAGG - Intergenic
983321332 4:166199686-166199708 AGCCTTACCAATTGTGAAGCCGG - Intergenic
987119433 5:14752891-14752913 AGCCAAACTTCTTGGGAGGGTGG - Intronic
994489297 5:100420917-100420939 GGCCTTACCAATTGTGAGGCAGG - Intergenic
996574250 5:124964164-124964186 GGCCATACCAGTTGTGAAGCCGG - Intergenic
1005157819 6:22827423-22827445 ATCCATACTTCTCTTGAGGCAGG + Intergenic
1007400657 6:41600519-41600541 AGCCACCCCTCCTGAGAGGCAGG + Exonic
1010464514 6:76151270-76151292 TGCCACATCTCTTCTGAGGCAGG + Intergenic
1010894611 6:81349085-81349107 AGCCAGACCAGTTGTGAGGAGGG + Intergenic
1011158034 6:84355570-84355592 ACCCAAACATCCTGTGAGGCAGG - Intergenic
1019495936 7:1340772-1340794 AGGCAAACCTCCTGGGAGGCGGG - Intergenic
1019498388 7:1352126-1352148 AGCCATAGCTCATGGGACGCAGG - Intergenic
1019611631 7:1939772-1939794 AGCCTGAGCTCTTGGGAGGCTGG - Intronic
1019655242 7:2190304-2190326 AGACATACGTATTGTGGGGCAGG + Intronic
1020769966 7:12378477-12378499 GGCCAAACCTTTTTTGAGGCAGG + Intronic
1020927448 7:14349300-14349322 ACCCATATCTCTTTTTAGGCTGG - Intronic
1022372805 7:29786606-29786628 AGCCAGACCTGGTGTGAGGAGGG - Intergenic
1029595416 7:101535173-101535195 AGTCTTAGCTCTTGTGGGGCAGG + Intronic
1034316773 7:150140282-150140304 AGCCATACCCCAAGTGAGCCAGG - Intergenic
1037366569 8:18128751-18128773 TGCCATACCTGGTGTGATGCTGG - Intergenic
1038777153 8:30541509-30541531 ATCCATCCCTCCTGAGAGGCAGG - Intronic
1041178435 8:55221904-55221926 AGTCCTACCTCTGGTGAGACAGG - Intronic
1041463074 8:58132652-58132674 AGCCAGACCTCATGCCAGGCAGG - Intronic
1043868517 8:85402694-85402716 AACCATAACTCTTGTGAGGGGGG - Intronic
1045010791 8:97956884-97956906 GGCCATTCCTCCTGGGAGGCAGG + Intronic
1046138837 8:110063641-110063663 AGCTATACCTCTTCAGAGGGGGG + Intergenic
1050657260 9:7842529-7842551 AGCCAAACCTATTCTGAAGCTGG + Intronic
1052240732 9:26269899-26269921 ATCCATACCTCTTTTGACACAGG - Intergenic
1057633111 9:96736852-96736874 AGCCATGACTCTTATGAGGAGGG - Intergenic
1057960355 9:99449913-99449935 AGACATACCTCCTGTGTGGGTGG - Intergenic
1061695977 9:132373808-132373830 AGCCTTAGTTCTTGTGAGGTGGG + Intergenic
1061724323 9:132573429-132573451 AGCCACACCTTTTTTGAGGGAGG + Intergenic
1189604642 X:42663401-42663423 AGTCTTACCTCTTGTAAGCCAGG + Intergenic
1196330755 X:114468519-114468541 AGCCAGACCTGGTGTGAGGAGGG - Intergenic
1197551610 X:127899318-127899340 TTCAGTACCTCTTGTGAGGCAGG - Intergenic