ID: 1107723103

View in Genome Browser
Species Human (GRCh38)
Location 13:43270145-43270167
Sequence TTTTAAGCAGGGCCACTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107723100_1107723103 -10 Left 1107723100 13:43270132-43270154 CCTACACTGCTATTTTTAAGCAG 0: 1
1: 0
2: 3
3: 21
4: 212
Right 1107723103 13:43270145-43270167 TTTTAAGCAGGGCCACTGTATGG 0: 1
1: 0
2: 2
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107723103 Original CRISPR TTTTAAGCAGGGCCACTGTA TGG Intronic
902790768 1:18766312-18766334 CTTGAAGCAGGGCCCCTGTGTGG - Intergenic
904616711 1:31753949-31753971 TTTTAGGGAGGGCCCCTGTAGGG - Intronic
906715255 1:47964063-47964085 GTTTAAGCAGGGGGAATGTAGGG - Intronic
906819856 1:48918177-48918199 AGTTAAGCAGGTCCACTGCAGGG + Intronic
907217780 1:52880591-52880613 TTGCTAGCAGGCCCACTGTAGGG + Intronic
907574240 1:55511606-55511628 TTTCAATCAGTGCCACTGCAAGG + Intergenic
910209467 1:84778444-84778466 TTTTACGCTGTGCCATTGTAAGG + Intergenic
911603877 1:99878611-99878633 TTATAAGCAGTGCCACTGTAGGG - Intronic
917299561 1:173559457-173559479 TTTTCAGCAAGGCCAATGCATGG + Intronic
920059073 1:203215177-203215199 TTTTAAGCAGGGGAACTGACAGG + Intronic
1065489102 10:26264898-26264920 GTTTCAGCAGGGCCAATGAACGG + Intronic
1068782067 10:60930682-60930704 TTTTTAGGAGGTTCACTGTAAGG - Intronic
1069896936 10:71685759-71685781 TCTCAAGCAGGGCCTCTGGATGG + Intronic
1070345895 10:75541530-75541552 TTTTAATCTGGGGCACAGTAGGG + Intronic
1071382372 10:85080550-85080572 TGTTAAGCTGTACCACTGTAGGG - Intergenic
1072789699 10:98309285-98309307 CTTAAAGCAGGGCCCCTGTGTGG + Intergenic
1078437590 11:11338279-11338301 TTTTAAGCAGGGCGATGGCATGG + Intronic
1079493509 11:21015423-21015445 TTTTAACCAAGGTCACTCTAAGG - Intronic
1080500139 11:32862837-32862859 TTGTAACCAGGGCCCCTGTGGGG + Intergenic
1087357235 11:97110155-97110177 TTTTCAGCAGAGCCTCTGTTTGG + Intergenic
1091751865 12:3027421-3027443 TTTTAAGTAGGTGAACTGTAAGG - Intronic
1092956808 12:13558893-13558915 ATTTAAGCATTGCCACTGAAAGG + Exonic
1094630643 12:32170592-32170614 TTTTACACAATGCCACTGTACGG + Intronic
1095651224 12:44611934-44611956 TACTAAGTAGTGCCACTGTAGGG - Intronic
1096174818 12:49507225-49507247 TTAAAGGCAGGGCCACTGTGGGG + Intronic
1098828833 12:75334030-75334052 TTTGGAACAGAGCCACTGTATGG - Intronic
1101519597 12:105469180-105469202 TATTAAGCAGAGCAACTGAATGG - Intergenic
1105342658 13:19542367-19542389 TTTTAAAAAGGACCACAGTATGG - Intergenic
1107439712 13:40415083-40415105 TCTTGAGCAGGGCCAGTTTATGG + Intergenic
1107723103 13:43270145-43270167 TTTTAAGCAGGGCCACTGTATGG + Intronic
1115372126 14:32628517-32628539 TTTTAACCTGGACCACTGAAAGG + Intronic
1117555281 14:56877496-56877518 TTCTAGCCAGGGCCACTGTGTGG + Intergenic
1120460152 14:84784669-84784691 CCTGAAGCAGGGCCAGTGTAGGG + Intergenic
1121952003 14:98179382-98179404 AGTCAAGCAGGGACACTGTATGG + Intergenic
1128219086 15:65955030-65955052 TTCTAAGATGGTCCACTGTATGG - Intronic
1131968523 15:97870209-97870231 TTCTAAGCAGGGCAACAGTAAGG - Intergenic
1136105045 16:28024393-28024415 TTTAGAGCAGGGCCACTGCCGGG + Intronic
1139058898 16:63223810-63223832 TGTTAAGCAGCACAACTGTATGG + Intergenic
1142474105 17:179863-179885 GTTAGAGCAGGGCCCCTGTAGGG - Intronic
1149649626 17:58268755-58268777 TTCTCAGAAGGGCCACTGGAAGG - Intergenic
1150621263 17:66809355-66809377 TTTTGTGTAGGGTCACTGTAAGG - Exonic
1153245552 18:3069921-3069943 TTTTAAGCTCAGCCACTGCAGGG - Intronic
1153314996 18:3712585-3712607 TTTTAAGCAGGCCCATTACAGGG + Intronic
1155204058 18:23542395-23542417 GCTTAATCAGGGCCATTGTAAGG - Intronic
1155534632 18:26804468-26804490 ATTCAAGCAGGGCTACTGTTTGG + Intergenic
1156380709 18:36558302-36558324 TAGTAAGCTGGGCCACTGGAGGG + Intronic
1158467083 18:57700102-57700124 TTCTTAGCAGGGCTACTGGAAGG - Intronic
926796433 2:16623125-16623147 TCTTACGCAGGCCCAGTGTAAGG - Intronic
927285308 2:21351308-21351330 TTTCAAGCAGGGATACTGCAGGG + Intergenic
927294950 2:21443477-21443499 TTTGAGGCAGGGCCACTGGGAGG + Intergenic
927914973 2:26929816-26929838 TCTTTAGCAGGGGGACTGTAGGG - Intronic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
930919013 2:56728490-56728512 TCTGAAACAGAGCCACTGTATGG + Intergenic
937456488 2:122045830-122045852 TTCTAAACAGGACCAATGTAGGG + Intergenic
938906901 2:135845898-135845920 TTTTAAACAGAACCATTGTAAGG + Intronic
939331720 2:140772113-140772135 TTTTATGTAGGGCCATTATATGG + Intronic
940258562 2:151757807-151757829 GTTTAAGCAGGGCCACTGGAGGG - Intergenic
940968560 2:159868868-159868890 TTTCAAGCAGGGCAACTTAATGG - Intronic
943932378 2:193869885-193869907 TTGCAAGCGTGGCCACTGTATGG - Intergenic
944939971 2:204613741-204613763 TTTTAAGCATAGCTATTGTATGG + Intronic
1171757003 20:29119761-29119783 TTTTAACCAAGGACACAGTACGG + Intergenic
1172145326 20:32753624-32753646 TTCTCACGAGGGCCACTGTACGG + Intergenic
1172444119 20:34984390-34984412 CTTGGAGCAGGGCCACTGCATGG + Intronic
1172892650 20:38278015-38278037 TTTGCAGCTGGACCACTGTAAGG - Intronic
1175329943 20:58156558-58156580 TTGTAAGCAGGGCCATGGAAAGG + Intronic
1176003690 20:62847683-62847705 TTTTGAACATGGCCACTGGAGGG - Intronic
1177781795 21:25629958-25629980 ATTTAAGCAGGGGCACTCTGTGG + Intergenic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
1185053296 22:48564893-48564915 TTTTTTGCAGGGCCACTGGGGGG - Intronic
950573682 3:13817838-13817860 TTTCAAGCAGGGCCACTGAGTGG - Exonic
953439010 3:42902130-42902152 GTTTAATCAGGCCCACTGGATGG - Intronic
954160162 3:48715603-48715625 TTTTATGCAGGGCCTGGGTAGGG - Intronic
959341661 3:105139016-105139038 TTTTAAGAAGTGCAATTGTAAGG + Intergenic
961700310 3:128738904-128738926 TCTTAAGCAAGGCCATAGTATGG + Intronic
961950788 3:130747163-130747185 TTTTAAGCAGGTGAACTTTATGG - Intergenic
965508317 3:169540494-169540516 TTTTAAGCAGGGCCATGACATGG - Intronic
966292145 3:178372213-178372235 TTTTAAGCAGGGAAATCGTATGG - Intergenic
974242705 4:59271726-59271748 ATTTCAGCAGGGCCAATATATGG - Intergenic
974277174 4:59737599-59737621 TTTTGAGCAGGGGGCCTGTAAGG - Intergenic
975704416 4:77097973-77097995 TTATAAGCAGGGTAAATGTAAGG - Intergenic
977873937 4:102127042-102127064 GTTTCAACAGGGACACTGTAAGG + Intergenic
984570685 4:181389014-181389036 TTTTAATCTGGGCTACTGAATGG + Intergenic
986745969 5:10745435-10745457 TTTGAAGCAGGCCGACTGCAGGG - Intronic
994753453 5:103766461-103766483 TTTGAAGAAGGTCCTCTGTAAGG + Intergenic
996070462 5:119125435-119125457 ATTTTAGCAGGGCCACTATATGG + Intronic
996107599 5:119522649-119522671 TTTAAAGAAGGGGCACTGTGGGG + Intronic
1004576788 6:16903802-16903824 TCATAAGCAGCGCCATTGTAAGG - Intergenic
1006310215 6:33252136-33252158 TCTTAACCAGGGGAACTGTATGG - Intronic
1011441680 6:87393730-87393752 ATTTAAGCAGGTCCACTTGACGG - Intronic
1012245700 6:96924156-96924178 TCCTAAGGAGGGCCACTGTAGGG + Intergenic
1012464675 6:99504104-99504126 TTTTAAGCAGGGCCATGATATGG + Intronic
1013697893 6:112725498-112725520 TTATAAGCATGCTCACTGTATGG - Intergenic
1017399458 6:154042665-154042687 TCTTAAACAGGGCTACTCTAAGG + Intronic
1023016596 7:35974355-35974377 ATTTTAGCAGGGCCAATATATGG - Intergenic
1023385452 7:39652436-39652458 TTTTAAACAGGACCATAGTAGGG + Intronic
1033170280 7:139077850-139077872 TCTCAAGTAGGGCCACTCTATGG - Intronic
1034295209 7:149966292-149966314 TCTGAGGCAGGGCCACTGTCAGG + Intergenic
1034719766 7:153280385-153280407 ATTTAAGGAGGGCAACTGTTTGG + Intergenic
1034810853 7:154130655-154130677 TCTGAGGCAGGGCCACTGTCAGG - Intronic
1038136967 8:24796821-24796843 TTTTAAGGAAGGCTACTGAATGG - Intergenic
1038562144 8:28589810-28589832 TTTGAAGCAGGGCTAATGTAAGG - Intergenic
1040958741 8:53007906-53007928 TTTTAAACAGGCAAACTGTATGG - Intergenic
1042204308 8:66313040-66313062 TGTTTAGAAGGTCCACTGTAGGG + Intergenic
1042655252 8:71088751-71088773 TTTTCAGCAGAACCACTGAATGG + Intergenic
1045664246 8:104468365-104468387 TTTTAAGAAGGGCAACAGGATGG + Intergenic
1046331996 8:112729676-112729698 TTTTAAGCAGGTACACTGTCAGG - Intronic
1047860153 8:128956890-128956912 GTTTAAGCCTGGTCACTGTAAGG + Intergenic
1047867567 8:129043778-129043800 TTTTAATCCAGACCACTGTAGGG + Intergenic
1049477722 8:142804567-142804589 CTTCAAGCAGTGCCCCTGTACGG + Intergenic
1050139553 9:2503094-2503116 TCTTCAGTAGGGCCACTCTAGGG + Intergenic
1052464372 9:28811427-28811449 TTTTAAGCAAGGCCACTACAAGG - Intergenic
1058556601 9:106175332-106175354 TTTTATTCAGAGCCATTGTAGGG + Intergenic
1059377461 9:113895998-113896020 TTTTAAGAATGTCCTCTGTATGG + Intronic
1199487403 X:148363034-148363056 TTTTAAGCAGTGTGGCTGTATGG + Intergenic
1200705972 Y:6442790-6442812 TTTTAAGCAGAGCCACTTACAGG + Intergenic
1201028138 Y:9721918-9721940 TTTTAAGCAGAGCCACTTACAGG - Intergenic
1202589675 Y:26469299-26469321 TTTTAAAAAGGACCACAGTATGG + Intergenic