ID: 1107727653

View in Genome Browser
Species Human (GRCh38)
Location 13:43316109-43316131
Sequence GAGTCCCTTGAGCCTGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 0, 2: 7, 3: 93, 4: 906}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107727653_1107727663 27 Left 1107727653 13:43316109-43316131 CCTCCACCAGGCTCAAGGGACTC 0: 1
1: 0
2: 7
3: 93
4: 906
Right 1107727663 13:43316159-43316181 GACAGGAGCTGGGAACATGCTGG 0: 1
1: 0
2: 8
3: 64
4: 430
1107727653_1107727656 0 Left 1107727653 13:43316109-43316131 CCTCCACCAGGCTCAAGGGACTC 0: 1
1: 0
2: 7
3: 93
4: 906
Right 1107727656 13:43316132-43316154 ATAGCACTAAGCAAGAAGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 161
1107727653_1107727658 10 Left 1107727653 13:43316109-43316131 CCTCCACCAGGCTCAAGGGACTC 0: 1
1: 0
2: 7
3: 93
4: 906
Right 1107727658 13:43316142-43316164 GCAAGAAGCCAGGGCCTGACAGG 0: 1
1: 1
2: 0
3: 23
4: 238
1107727653_1107727660 17 Left 1107727653 13:43316109-43316131 CCTCCACCAGGCTCAAGGGACTC 0: 1
1: 0
2: 7
3: 93
4: 906
Right 1107727660 13:43316149-43316171 GCCAGGGCCTGACAGGAGCTGGG 0: 1
1: 0
2: 4
3: 100
4: 1012
1107727653_1107727657 1 Left 1107727653 13:43316109-43316131 CCTCCACCAGGCTCAAGGGACTC 0: 1
1: 0
2: 7
3: 93
4: 906
Right 1107727657 13:43316133-43316155 TAGCACTAAGCAAGAAGCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 215
1107727653_1107727659 16 Left 1107727653 13:43316109-43316131 CCTCCACCAGGCTCAAGGGACTC 0: 1
1: 0
2: 7
3: 93
4: 906
Right 1107727659 13:43316148-43316170 AGCCAGGGCCTGACAGGAGCTGG 0: 1
1: 1
2: 1
3: 49
4: 503
1107727653_1107727664 28 Left 1107727653 13:43316109-43316131 CCTCCACCAGGCTCAAGGGACTC 0: 1
1: 0
2: 7
3: 93
4: 906
Right 1107727664 13:43316160-43316182 ACAGGAGCTGGGAACATGCTGGG 0: 1
1: 0
2: 5
3: 33
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107727653 Original CRISPR GAGTCCCTTGAGCCTGGTGG AGG (reversed) Intronic
900644543 1:3703025-3703047 GAGTCCCCCGAGCCAGGTGGAGG + Intronic
900809978 1:4794483-4794505 GAGTGCCCTGCGCCTGGTGCTGG - Intergenic
900967424 1:5968512-5968534 GAATCGCTTGAGGCTGGAGGCGG + Intronic
901087054 1:6617172-6617194 GAATCCCTTGAACCCGGGGGTGG - Intronic
901310311 1:8264452-8264474 GAATCACTTGAACCTGGGGGTGG - Intergenic
901848658 1:12001096-12001118 GAATCACTTGAACCTGGAGGCGG - Intronic
902028606 1:13403983-13404005 GAATCACTTGAGTCTGGAGGCGG - Intergenic
902534959 1:17114205-17114227 CTGTCCCTTGAGGCTGGGGGTGG + Intronic
902762985 1:18596384-18596406 GAATCACTTGAACCTGGAGGCGG + Intergenic
903056723 1:20641210-20641232 GAGTCCCTGCAGGCCGGTGGAGG + Intronic
903226862 1:21898743-21898765 GGGTCCCCTCAACCTGGTGGGGG + Intronic
903399222 1:23027512-23027534 GGATCACTTGAACCTGGTGGGGG - Intronic
903670701 1:25033901-25033923 GAGTCCCTTGAGCCCCAGGGAGG + Intergenic
903901697 1:26650948-26650970 GAATCGCTTGAGCCCGGTGACGG + Intergenic
903975531 1:27147402-27147424 GAATCACTTGAACCTGGAGGCGG + Intronic
904295364 1:29516781-29516803 CAGTCACTGCAGCCTGGTGGGGG + Intergenic
904362137 1:29983111-29983133 GGGTGCCTAGAACCTGGTGGGGG - Intergenic
904683660 1:32246036-32246058 GAATCACTGGAGCCTGGAGGCGG - Intergenic
904735414 1:32628547-32628569 GAATCGCTTGAGCCAGGAGGCGG + Intronic
904765945 1:32846866-32846888 GAATCGCTTGAACCTGGAGGCGG - Intronic
905016986 1:34784748-34784770 CAGTCCATGGCGCCTGGTGGGGG - Exonic
905156691 1:35989785-35989807 GAATCACTTGAGCCGGGAGGTGG + Intronic
905360401 1:37415381-37415403 GAATCACTTGACCCTGGAGGTGG + Intergenic
905458566 1:38105695-38105717 GAATCACTTGAACCTGGAGGTGG - Intergenic
905719252 1:40182344-40182366 GAGTCTCTTGAACCTGGGAGGGG + Intronic
905723283 1:40225962-40225984 GAATCGCTTGAGCCTGGGAGTGG + Intronic
905728199 1:40273428-40273450 GAATCGCTTGAACCTGGAGGTGG + Intronic
905925112 1:41744124-41744146 GAATCGCTTGAACCTGGAGGCGG - Intronic
906192757 1:43908717-43908739 GAATCACTTGAACCTGGAGGGGG - Intronic
906227442 1:44133446-44133468 GAGTCCTTTGGGTCTGATGGAGG - Exonic
906298575 1:44664361-44664383 GAATCGCTTGAACCTGGTGGTGG + Intronic
906467962 1:46101416-46101438 GAATCGCTTGAACCTGGAGGCGG + Intronic
906534034 1:46541670-46541692 GAATCGCTTGAACCTGGAGGCGG - Intergenic
906546879 1:46626009-46626031 GAATCCCTTGAACCAGGAGGCGG + Intergenic
906861831 1:49368985-49369007 GAATCGCTTGAACCTGGTGGGGG + Intronic
907018051 1:51036350-51036372 GAATGGCTTGAGCCTGGTGGGGG - Intergenic
907049773 1:51322118-51322140 GACTCCCTTTACCCTTGTGGAGG - Intronic
907165782 1:52409521-52409543 GAATCCCTTGAACCAGGAGGCGG + Intronic
907179585 1:52557847-52557869 GAATCACTTGAGCCCGGGGGTGG + Intergenic
907260109 1:53211684-53211706 GAATCACTTGAACCTGGGGGTGG - Intronic
907304737 1:53507179-53507201 GAGTTTCTTGAGTCTGGTTGGGG - Intronic
907953547 1:59206777-59206799 GGGACCCTTGAGATTGGTGGGGG + Intergenic
908393951 1:63708032-63708054 GAGTGCTTTGATCCTGGGGGTGG - Intergenic
908407341 1:63828131-63828153 CAGTAACTTGAGCCTGTTGGTGG + Intronic
909003073 1:70242381-70242403 GGATGGCTTGAGCCTGGTGGGGG - Intronic
909322144 1:74303278-74303300 GAATCACTTGAACCTGGGGGTGG - Intronic
910160041 1:84262940-84262962 CAGTCCTCTGAGCCTTGTGGGGG - Intergenic
911080727 1:93927284-93927306 GAATCACTTGAACCTGGAGGTGG + Intergenic
911157558 1:94652116-94652138 GGCTCCCATGAGCCTGGAGGAGG + Intergenic
911941870 1:104057367-104057389 GGGACACTTGAGCTTGGTGGGGG + Intergenic
913113791 1:115678865-115678887 GAATCCCTTGAACCTGGAGGTGG + Intronic
914800957 1:150962254-150962276 GAATCTCTTGAGCCTGGGAGGGG - Intronic
915367865 1:155325453-155325475 CAGCCCCTGGAGCGTGGTGGAGG + Exonic
915984972 1:160455641-160455663 GAATCACTTGAGCCTGGGAGGGG - Intergenic
916281729 1:163059049-163059071 GAATCACTTGAACCTGCTGGGGG + Intergenic
916752820 1:167739027-167739049 GAATCGCTTGAACCTGGAGGTGG - Intronic
916795470 1:168163226-168163248 GAGTCTCTTGAACCTGGGAGGGG - Intergenic
917371681 1:174300435-174300457 GAATCCCTTGAACTCGGTGGTGG + Intronic
917430398 1:174961756-174961778 GAATCGCTTGAGCCTGGGAGGGG + Intronic
917471090 1:175326532-175326554 GAGTCCCTGGAGACTGGAAGGGG - Intronic
917576260 1:176324650-176324672 GAATCACTTGAACCTGGGGGTGG - Intergenic
918678232 1:187317526-187317548 GAATCGCTTGAACCAGGTGGTGG - Intergenic
919282645 1:195511047-195511069 GAATCGCTTGAACCTGGGGGTGG - Intergenic
920019376 1:202942954-202942976 GAATCACTTGAACCTGGTCGGGG - Intronic
920243712 1:204572600-204572622 GAATCACTTGAACCTGGTGAGGG + Intergenic
920497115 1:206462904-206462926 GAGACCCATGAGCCTGGCTGTGG - Exonic
920681364 1:208075221-208075243 GAATCCCTTGAACCCGGAGGCGG + Intronic
921103396 1:211951393-211951415 GAATCGCTTGAACCGGGTGGCGG - Intronic
921125826 1:212177160-212177182 CAGTCCCTTTAACCTGGTGGAGG + Intergenic
921693272 1:218177592-218177614 GAATCTCTTGAACCTGGGGGCGG + Intergenic
921851575 1:219937723-219937745 GAATCGCTTGAACCTGGAGGCGG + Intronic
922301161 1:224302287-224302309 GAATCACTTGAACCTGGAGGCGG - Intronic
922350613 1:224732163-224732185 GAGAGCCTTGACCCAGGTGGTGG + Intronic
922927350 1:229361051-229361073 GACTCGCTTGAACCGGGTGGTGG - Intergenic
923297397 1:232608131-232608153 GAGTCGCTTAAGTCTGGAGGTGG - Intergenic
923398881 1:233595918-233595940 GAGTCGCTTGAACCTGGGAGGGG + Intergenic
923491100 1:234484810-234484832 GAATCCCTTGGACCTGGAGGCGG + Intergenic
924234982 1:241993089-241993111 GAATCGCTTGAGCCGGGAGGTGG + Intergenic
924534793 1:244926411-244926433 GAATCACTTGAACCTGGAGGCGG - Intergenic
924688048 1:246316445-246316467 GACTCCCTTGAACCTGGGAGGGG - Intronic
1062783641 10:241263-241285 GAATCACTTGAGCCTGGAGGAGG - Intronic
1063416835 10:5880069-5880091 GAATCACTTGAGCCAGGAGGTGG + Intronic
1063448153 10:6133205-6133227 GAATCGCTTGAACCTGGTGGAGG + Intergenic
1063637541 10:7798322-7798344 GAATCGCTTGAGCCTGGGAGGGG - Intronic
1063696685 10:8342563-8342585 GAGACCCTAGAGGATGGTGGAGG + Intergenic
1063806650 10:9652216-9652238 GAATCACTTGAACCTGGGGGGGG + Intergenic
1064365273 10:14701839-14701861 GAGTCCCTGGAACCTGGAGCAGG + Intronic
1065073102 10:22048334-22048356 GAATCACTTGAACCTGGAGGCGG - Intergenic
1065380752 10:25087606-25087628 GAATCGCTTGAACTTGGTGGGGG + Intergenic
1065560486 10:26959189-26959211 GAATCACTTGAACCTGGAGGCGG + Intergenic
1065724633 10:28657683-28657705 GAATCACTTGAACCTGGAGGTGG + Intergenic
1065846447 10:29747523-29747545 GAGGCCCATGAGGGTGGTGGTGG + Intergenic
1066072952 10:31838912-31838934 GAATCACCTAAGCCTGGTGGGGG + Intronic
1066796499 10:39127475-39127497 GAGTCCATTGAGCCCTATGGGGG + Intergenic
1066816254 10:39418731-39418753 GAGTGCTTTGAGCCCTGTGGTGG + Intergenic
1067150763 10:43731132-43731154 GACTCCCTTTAGCATTGTGGGGG - Intergenic
1067217272 10:44313676-44313698 GAATCCCTTGAACCTGGAGGCGG + Intergenic
1068208561 10:53890337-53890359 GAATCGCTTGAACCTGGAGGCGG + Intronic
1068385894 10:56327060-56327082 AAGTCCCTTGCGACTGGAGGAGG - Intergenic
1069094626 10:64244031-64244053 GAATCCCTTGAACCTGGAGGTGG - Intergenic
1069369263 10:67728544-67728566 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1069416535 10:68205597-68205619 GAGTCTCTTGAACCTGGGAGGGG + Intronic
1069418288 10:68222257-68222279 GAATCGCTTGACCCTGGAGGCGG + Intergenic
1069459128 10:68577719-68577741 GAATCGCTTGAACCTGGAGGGGG + Intronic
1069510703 10:69040464-69040486 GAATCCCTTGAACCTGGGAGGGG - Intergenic
1069585177 10:69595132-69595154 GAATCACTTGAGCCGGGAGGTGG + Intergenic
1069927340 10:71859926-71859948 GAATCGCTTGAACCTGGTGGGGG + Intergenic
1070096006 10:73339004-73339026 GAATCACTTGAACCTGGAGGTGG - Intronic
1070126634 10:73627139-73627161 GAATCCCTTGAGCTGGGAGGTGG + Intergenic
1070253691 10:74795854-74795876 GAATCGCTTGAGCCAGGAGGTGG + Intergenic
1070613037 10:77947507-77947529 GGATCACTTGAGCCAGGTGGAGG - Intergenic
1071002015 10:80841597-80841619 GGGACACTTGAGCTTGGTGGGGG - Intergenic
1071296550 10:84224639-84224661 GATTCTCTCCAGCCTGGTGGTGG - Exonic
1071531767 10:86395235-86395257 GAATCACTTGAGCCTGGGAGTGG - Intergenic
1072581701 10:96745458-96745480 GAATCACTTGAACCTGGAGGCGG + Intergenic
1072658413 10:97346949-97346971 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1073052714 10:100679179-100679201 GAATCACTTGAACCTGGGGGCGG - Intergenic
1073097017 10:100986000-100986022 ATGTCCCTTGAGCCAGCTGGTGG - Intronic
1073305502 10:102500668-102500690 GAATCTCTTGAACCTGGAGGCGG + Intronic
1073346224 10:102784961-102784983 GAATCACTTGAACCTGGAGGCGG - Intronic
1073504984 10:103977525-103977547 GGATCCCTTGAACTTGGTGGAGG + Intronic
1073697986 10:105892464-105892486 GAGTCACTTGAACCTGGAAGGGG - Intergenic
1074016754 10:109542414-109542436 GGGACTCTTGAGCTTGGTGGGGG - Intergenic
1074067593 10:110031184-110031206 GAATCCCTTGAACCCGGAGGGGG + Intronic
1074095297 10:110306078-110306100 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1074820351 10:117173821-117173843 GAATTGCTTGAACCTGGTGGAGG - Intergenic
1075109821 10:119569835-119569857 GAATCCCTTGAACCGGGAGGCGG - Intergenic
1075840716 10:125500156-125500178 GAATCGCTTGAGCCTGGGAGGGG - Intergenic
1076144377 10:128105502-128105524 GTGTCCATTGATTCTGGTGGTGG + Exonic
1077509837 11:2952742-2952764 TAGGCCCTGGAGCCTGCTGGAGG - Intronic
1077765610 11:5156779-5156801 GAATCGCTTGAACCTGGTGGGGG - Intronic
1078018577 11:7636488-7636510 CAGTCCCTTGAGCCTGGGGTTGG + Intronic
1078089867 11:8258353-8258375 GAGTGCCTTGAGCCACGTTGGGG - Intronic
1078767649 11:14314774-14314796 GAATCACTTGAACCTGGAGGCGG - Intronic
1078851828 11:15171254-15171276 GTTTCCTTTGAGCCAGGTGGTGG + Intronic
1079064697 11:17279103-17279125 GAATCGCTTGAACCTGGAGGCGG + Intronic
1079900932 11:26183664-26183686 GAATCACTTGAACCTGGAGGTGG + Intergenic
1080230499 11:30014446-30014468 TAGTCCCTTGAGCAGAGTGGAGG - Intronic
1080331877 11:31148415-31148437 TAATCGCTTGAGCCTGGAGGTGG + Intronic
1080649160 11:34209258-34209280 GAATTACTTGAACCTGGTGGAGG + Intronic
1080649813 11:34213042-34213064 GAATCCTTTGGGCCTGCTGGGGG + Intronic
1080887301 11:36377990-36378012 GGGTCCCTTGAGGATGGTGGGGG - Intronic
1081031111 11:38084932-38084954 GAATCACTTGAACCCGGTGGCGG - Intergenic
1081037760 11:38170528-38170550 GAATCGCTTGAACCTGGCGGGGG + Intergenic
1081773711 11:45664559-45664581 GGGTCCCTGGAGCCTGGGAGGGG + Intronic
1081889419 11:46528257-46528279 GAATCGCTTGAACCTGGAGGTGG - Intronic
1082058296 11:47838618-47838640 GAATCACTTGAACCTGGGGGGGG + Intronic
1082081344 11:48014788-48014810 GAATCGCTTGAACCTGGTGGAGG - Intronic
1082081491 11:48015761-48015783 GAATCCCTTGAACCTGGTGGAGG + Intronic
1082127829 11:48453654-48453676 GAGATGCTTGAGCTTGGTGGGGG - Intergenic
1083290357 11:61686536-61686558 GAGTTCTCTGAGCCTGGAGGAGG + Intronic
1083568635 11:63742556-63742578 GAGTCGCTTGAACCTGGATGCGG + Intronic
1083692060 11:64415411-64415433 GATGCCCTGGAGCCTGGGGGAGG + Intergenic
1083724881 11:64622902-64622924 GGGTCACCTGCGCCTGGTGGGGG - Exonic
1084005690 11:66322416-66322438 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1084332827 11:68439802-68439824 GAGCTCCGTGAGCCTGATGGGGG + Exonic
1084843222 11:71875936-71875958 GATTCACTTGAACCTGGAGGTGG + Intronic
1085385939 11:76158440-76158462 CATCCCCTTGAGCCTGGGGGTGG - Intergenic
1085647331 11:78234168-78234190 GGATCACTTGAGCCTGGGGGAGG - Intronic
1086094333 11:83035457-83035479 GAGTCTCTGGATCATGGTGGTGG - Intronic
1086338838 11:85826719-85826741 AACTCCCTTCAGCCTGGAGGTGG + Intergenic
1086853658 11:91840748-91840770 GAGTAGCCTGAGCCTGGTGTTGG - Intergenic
1088144953 11:106665301-106665323 GAGTCCCTGGGGCCAGGTTGGGG + Intergenic
1088464962 11:110125406-110125428 GAATCCCTTGAACCTGGAGGTGG - Intronic
1088465912 11:110138642-110138664 GAATCGCTTGAACCTGGGGGCGG - Intronic
1088500051 11:110474054-110474076 TAGTATATTGAGCCTGGTGGTGG + Intergenic
1089226149 11:116924204-116924226 GAATCGCTTGAACCTGGGGGAGG + Intronic
1089596018 11:119580773-119580795 GAGTTGCTTAAGGCTGGTGGTGG - Intergenic
1089737504 11:120560134-120560156 GAATCCCTTGAACCCGGAGGTGG - Intronic
1089811144 11:121132807-121132829 GAATTGCTTGAACCTGGTGGGGG - Intronic
1089974565 11:122721155-122721177 GAATCGCTTGAACCCGGTGGTGG + Intronic
1090375918 11:126289363-126289385 GAATCTCTTGAACCTGGAGGCGG - Intronic
1091887179 12:4025237-4025259 AAGGCCCTTGAGCCTGGGAGGGG + Intergenic
1092361132 12:7837549-7837571 GAATCTCTTGAACCTGGGGGCGG + Intronic
1092747459 12:11687266-11687288 GAATCGTTTGAACCTGGTGGGGG - Intronic
1093531236 12:20166571-20166593 GAATCGCTTGAACCTGGTTGGGG + Intergenic
1093759601 12:22893061-22893083 CAGTCACTTGAAGCTGGTGGGGG + Intergenic
1094020926 12:25913519-25913541 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1094569340 12:31628148-31628170 GAATCACTTGAACCTGGCGGCGG - Intergenic
1094581927 12:31741110-31741132 GGATCGCTTGAGCCTGGGGGGGG + Intergenic
1094727486 12:33135170-33135192 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1094844046 12:34353730-34353752 GAGTCTCTTTCGCCTGGTGGGGG + Intergenic
1094844739 12:34356477-34356499 GAGTCACTTTCGCCTGTTGGGGG + Intergenic
1095407322 12:41881350-41881372 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1096165987 12:49424765-49424787 GAATCACTTGAATCTGGTGGGGG - Intronic
1096362242 12:50997898-50997920 GAATCGCTTGAACCTGGGGGTGG + Intronic
1096393765 12:51249702-51249724 GAATCGCTTGAGCCAGGAGGTGG - Intronic
1096588667 12:52642944-52642966 GAATCACTTGAGCCGGGAGGCGG + Intergenic
1096711032 12:53456174-53456196 GAGTCACTTGAGGCTGGGCGTGG + Intronic
1096724521 12:53550234-53550256 GAATCGCTTGAGCCTGGGAGGGG + Intronic
1097025835 12:56054770-56054792 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1097163569 12:57068436-57068458 GAACCGCTTGAGCCTGGAGGCGG - Intronic
1097230911 12:57510382-57510404 GAATCGCTTGAACCTGGAGGTGG + Intronic
1097240785 12:57573739-57573761 GAATCGCTTGAACCTGGAGGCGG + Intronic
1098295976 12:69004640-69004662 GAATCACTTGAACCAGGTGGCGG - Intergenic
1098697066 12:73572688-73572710 GGGACCCTCGAGCTTGGTGGTGG + Intergenic
1098854181 12:75633484-75633506 GAATCACTTGAGCCTGGGGGTGG + Intergenic
1099071365 12:78049066-78049088 GGGACCCTGGAGCTTGGTGGGGG - Intronic
1099403456 12:82228810-82228832 GAATCGCTTGAACCTGGAGGTGG + Intronic
1099612968 12:84898251-84898273 GAATCACTTGAGCCAGGAGGTGG + Intronic
1100242908 12:92727674-92727696 GAATCGCTTGAACCTGGAGGTGG - Intronic
1100490279 12:95072364-95072386 GAATCGCTTGAACCTGGAGGCGG + Intronic
1100740050 12:97581684-97581706 GGGACACTTGAGCTTGGTGGCGG + Intergenic
1100838094 12:98586121-98586143 GAATCGCTTGAACCTGGGGGCGG + Intergenic
1101083383 12:101210543-101210565 GAGCCCCTTCAGCCTGTTGTTGG + Intergenic
1101258478 12:103004469-103004491 GAATCACTTGAACCTGGAGGTGG - Intergenic
1101340535 12:103839023-103839045 CAGTCCCTTGACTGTGGTGGTGG + Intronic
1101781366 12:107840945-107840967 GAATCTCTTGAACCTGGAGGCGG - Intergenic
1101946014 12:109137983-109138005 GAATCACTTGAACCTGGAGGTGG - Intronic
1102242012 12:111330295-111330317 GAGTCCCCAGAGCCTGGGGGTGG - Intronic
1102456852 12:113076369-113076391 GAATCGCTTGAACCTGGAGGCGG + Intronic
1102564333 12:113785238-113785260 GGATCACTTGAGCCTGGGGGCGG + Intergenic
1102934330 12:116883804-116883826 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1103076447 12:117986544-117986566 GAATCACTTGAACCTGGAGGTGG + Intergenic
1103258261 12:119562220-119562242 GAATCACTTGAGCCAGGAGGTGG - Intergenic
1103378822 12:120478193-120478215 GAATCACTTGAACCTGGGGGTGG - Intronic
1103769784 12:123312622-123312644 GAACCCTTTGAACCTGGTGGCGG + Intronic
1103983776 12:124753815-124753837 GGGTCCCATCAGCCTGGTGTGGG - Intergenic
1103990402 12:124795299-124795321 GTGTCCCTGGAGCTTGGGGGTGG - Intronic
1104157065 12:126143586-126143608 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1104442625 12:128806988-128807010 GAGTCGCTTGAACCGGGAGGTGG - Intronic
1105324419 13:19356849-19356871 GAATCACTTGAACCTGGCGGGGG - Intergenic
1105370978 13:19801722-19801744 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1105483134 13:20798054-20798076 GAGTCGCTTGACCCAGGAGGTGG + Intronic
1105694956 13:22878952-22878974 GAATCGCTTGAACCTGGCGGAGG + Intergenic
1105959072 13:25312453-25312475 GAGTCACTTGAACCTGGGAGGGG - Intronic
1106009131 13:25801174-25801196 GAGTACCTAGAGCCTGGAGGTGG - Intronic
1106118310 13:26836499-26836521 GTTTCTCTTGACCCTGGTGGTGG - Intergenic
1106301908 13:28474366-28474388 GAATCACTTGAACCTGGAGGAGG + Intronic
1106391158 13:29336990-29337012 GGGACCCTTGAGCTTGGTGGGGG - Intronic
1106934197 13:34700258-34700280 TAGTCTCTTGGGCCTGGTGCAGG - Intergenic
1107727653 13:43316109-43316131 GAGTCCCTTGAGCCTGGTGGAGG - Intronic
1108674038 13:52721147-52721169 GGGACACTTGAGCTTGGTGGGGG - Intronic
1109008727 13:56911342-56911364 GAATCACTTGAACCTGGAGGTGG + Intergenic
1109195932 13:59377419-59377441 GGGACTCTTGAGCTTGGTGGGGG + Intergenic
1110216965 13:73034026-73034048 GAGTCACTTGAGCTGGGAGGTGG + Intergenic
1110728374 13:78852670-78852692 GAAGGCCTAGAGCCTGGTGGGGG - Intergenic
1110892083 13:80706311-80706333 GGGTCCCAAGAGCCTGGGGGGGG - Intergenic
1112472335 13:99700355-99700377 GAATCACTTGAACCTGGAGGCGG + Intronic
1112834346 13:103495803-103495825 GAATCACTTGAACCTGGGGGTGG - Intergenic
1114554254 14:23552378-23552400 GAATCGCTTGAACCCGGTGGTGG - Intronic
1115089220 14:29553946-29553968 GAATCTCTTGAACCTGGAGGTGG - Intergenic
1115528768 14:34306538-34306560 GAATCACTTGAGCCTGGGGTGGG - Intronic
1115566595 14:34630067-34630089 GAGTCCCGGGAGCGCGGTGGGGG - Intronic
1115580050 14:34748523-34748545 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1115812762 14:37128673-37128695 GGATCACCTGAGCCTGGTGGTGG - Intronic
1115982906 14:39073378-39073400 GAATCACTTGAACCTGGAGGTGG - Intronic
1116395911 14:44448509-44448531 GAGTCCATTCAGTCTGTTGGAGG + Intergenic
1116743866 14:48792758-48792780 GACTCTCTAGAGCTTGGTGGGGG + Intergenic
1116816776 14:49591397-49591419 GAATCGCTTGAGCCGGGAGGTGG - Intronic
1117054646 14:51899260-51899282 GAGTGGCTGGAACCTGGTGGAGG - Intronic
1117121067 14:52568587-52568609 GAGACACTGGAGCTTGGTGGGGG + Intronic
1117786240 14:59289001-59289023 GAATCGCTTGAACCTGGAGGTGG - Intronic
1117930536 14:60837069-60837091 GGGACACTTGAGCTTGGTGGGGG - Intronic
1118386175 14:65257270-65257292 GAGTCACTTGAACCGGGAGGCGG + Intergenic
1118973201 14:70654501-70654523 GAGTTGCTTGAACCTGGGGGCGG + Intronic
1119259882 14:73231853-73231875 GTGTCCCAGGAGCATGGTGGAGG + Intergenic
1119351014 14:73965632-73965654 GAATCGCTTGAACCTGGGGGCGG + Exonic
1119422158 14:74513713-74513735 GAATCGCTTGAACCCGGTGGGGG + Intronic
1119581386 14:75785265-75785287 GAATCGCTTGAACCTGGAGGTGG - Intronic
1119676036 14:76555436-76555458 GAATCGCTTGAGCCAGGAGGTGG - Intergenic
1120204365 14:81572358-81572380 GAATCACTTGAACCTGGAGGAGG - Intergenic
1120871166 14:89338703-89338725 GAATCACTTGAACCTGGGGGTGG + Intronic
1120876382 14:89379746-89379768 GAATCCCTTGAACCTGGTGGTGG - Intronic
1120902655 14:89589440-89589462 CAGTTCCTTGAGCCTGGTCGTGG + Intronic
1121043604 14:90771505-90771527 GGATCTCTTGAGCCTGGTGCAGG + Intronic
1121256900 14:92537737-92537759 GAATCGCTGGAACCTGGTGGCGG - Intronic
1121459654 14:94065134-94065156 GAATCGCTTGAACCTGGAGGTGG - Intronic
1121466913 14:94121669-94121691 GGGTCCCTTGAGTCTCCTGGTGG - Intergenic
1121561035 14:94875829-94875851 GAGTCGCTTGAACCTGGGAGGGG - Intergenic
1121563758 14:94893637-94893659 GAGTCCCCTCAGTCTGTTGGTGG - Intergenic
1123387928 15:19837344-19837366 GAGTGCTTTGAGCCCAGTGGTGG - Intergenic
1123672042 15:22668535-22668557 GAGTCACTTGAACCTGGAGGAGG - Intergenic
1123726762 15:23110736-23110758 GGATCGCTTGAGCCTGGTGTGGG - Intergenic
1123936478 15:25196520-25196542 TGGCACCTTGAGCCTGGTGGGGG + Intergenic
1123943510 15:25227949-25227971 CACCTCCTTGAGCCTGGTGGGGG + Intergenic
1124324088 15:28741747-28741769 GAGTCACTTGAACCTGGAGGAGG - Intergenic
1124414138 15:29460542-29460564 GAATCACTTGAGCCCGGAGGCGG + Intronic
1124527974 15:30474994-30475016 GAGTCACTTGAACCTGGAGGAGG - Intergenic
1124770684 15:32532714-32532736 GAGTCACTTGAACCTGGAGGAGG + Intergenic
1125169205 15:36746835-36746857 GGGTCACTTGAGCCTGGAAGAGG - Intronic
1125573864 15:40741714-40741736 GAATCACTTGAACCTGGAGGCGG - Intronic
1125648812 15:41296375-41296397 GAATCACTTGAACCTGGAGGCGG - Intergenic
1125699125 15:41665479-41665501 GGATCCCTCGAGCCTGGGGGTGG - Intronic
1125822112 15:42640731-42640753 GAATCGCTTGAACCTGGAGGTGG + Intronic
1126050833 15:44683382-44683404 GGGACACTTGAGCTTGGTGGGGG + Intronic
1126444581 15:48727837-48727859 GAATCGCTTGAACCTGGAGGTGG + Intronic
1126591711 15:50346875-50346897 GAATCGCTTGAACCTGGGGGGGG - Intronic
1127236209 15:57055312-57055334 GAATCGCTTGAACCTGGAGGCGG + Intronic
1127758520 15:62115634-62115656 GAATCGCTTGAGCCTGGAGGCGG + Intergenic
1127835488 15:62787777-62787799 GAATCGCTTGAACCCGGTGGCGG - Intronic
1127942587 15:63714634-63714656 GAATCGCTTGAACCTGGGGGTGG - Intronic
1128082358 15:64864208-64864230 TGGTCCCTGGAGCCTGGTGGGGG + Intronic
1128129960 15:65220001-65220023 GAGTCACTTGAACCAGGAGGGGG - Intergenic
1128274006 15:66337407-66337429 GAATCACTTGAACCCGGTGGAGG - Intronic
1129043071 15:72707264-72707286 GAATCACTTGAACCTGGTGCGGG - Intronic
1129572914 15:76708976-76708998 GAATCTCTTGAACCTGGTAGGGG + Intronic
1129811601 15:78515493-78515515 GAATCGCTTGAGCCAGGAGGTGG + Intronic
1129927672 15:79380261-79380283 GAATCGCTTGAACCTGGAGGTGG + Intronic
1130242395 15:82207808-82207830 GAATCCCTTGAACCCGGGGGAGG - Intronic
1130318073 15:82813742-82813764 GAGTCGCTTGAACCTGGAGGAGG - Intronic
1130661651 15:85835509-85835531 GAATCGCTTGAGCCTGGAGGTGG + Intergenic
1131396011 15:92086886-92086908 GAATCACTTGAACCTGGTGTGGG + Intronic
1131475176 15:92732254-92732276 GAATCACTTGAACCTGGAGGCGG + Intronic
1131509727 15:93043350-93043372 GGCTCCCTTGAGGCGGGTGGAGG - Intronic
1132096416 15:98988282-98988304 AGGACCCTTGAGCTTGGTGGGGG + Intronic
1132168386 15:99620930-99620952 GAATCACTTGAACCTGGAGGCGG - Intronic
1132364621 15:101248427-101248449 GAGTGCATGGAGCCTGGAGGTGG - Intronic
1132695068 16:1198404-1198426 GTGTCCCTGGAGGCCGGTGGTGG + Intronic
1132750634 16:1455860-1455882 GGTTCCCTGGAGCCTGGGGGAGG - Intronic
1132990861 16:2792542-2792564 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1133004241 16:2869016-2869038 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1133174239 16:4001834-4001856 GAATCTCTTGAACCTGGAGGCGG - Intronic
1133334496 16:4998091-4998113 GAATCGCTTGAACCTGGCGGGGG - Intronic
1133345024 16:5064036-5064058 GAATCGCTTGAACCTGGAGGTGG + Intronic
1133558022 16:6924080-6924102 GAGTCGCTTGAACCCGGAGGTGG + Intronic
1133558288 16:6926217-6926239 GACTCCCTTGAACCTGGGAGGGG + Intronic
1133684224 16:8150429-8150451 GAATCACTTGAACCTGGAGGTGG + Intergenic
1134078196 16:11307037-11307059 GAATCACTTGAACCTGGAGGCGG + Intronic
1134131057 16:11650618-11650640 GAATCCTTTGAACCCGGTGGAGG - Intergenic
1134353888 16:13463066-13463088 GGATCACTTGAGCCTGGGGGGGG + Intergenic
1134443751 16:14314992-14315014 GAATCGCTTGAACCTGGTGGCGG + Intergenic
1134686263 16:16160716-16160738 GAATCCCTTGAGCCTGGAGATGG + Intronic
1134906896 16:17987705-17987727 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1135013613 16:18905697-18905719 GAATCACTTGAACCTGGAGGTGG - Intronic
1135095001 16:19557470-19557492 GAATCACTTGAGCCGGGAGGCGG - Intronic
1135320555 16:21493266-21493288 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1135342763 16:21663397-21663419 GAATCGCTTGAACCTGGGGGCGG + Intergenic
1135373390 16:21924756-21924778 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1135396037 16:22132293-22132315 GAATCGCTTGAACCTGGAGGGGG + Intronic
1135409518 16:22222794-22222816 GAATCACTTGAACCTGGGGGTGG + Intronic
1135438399 16:22445946-22445968 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1136058780 16:27710268-27710290 GAGTCGCTTGAACCTGGGAGGGG + Intronic
1136104025 16:28016075-28016097 AAATCACTTGAGCCTGGAGGTGG - Intronic
1136330771 16:29574965-29574987 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1136379256 16:29884502-29884524 GAATCGCTTGAACCTGGAGGAGG + Intronic
1136386227 16:29927806-29927828 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1136445404 16:30314692-30314714 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1136484621 16:30563428-30563450 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1137558819 16:49490060-49490082 GAGAGCATTGAGACTGGTGGCGG - Exonic
1137809504 16:51339461-51339483 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1137981870 16:53076684-53076706 GAATCACTTGAACCTGGAGGTGG + Intronic
1138636698 16:58345031-58345053 GAATCCCTTGAACCGGGAGGTGG + Intronic
1138843653 16:60539121-60539143 GAGACACTTGAGCTTGGTGGGGG - Intergenic
1138876531 16:60957749-60957771 GAATCGCTTGAACCTGGGGGCGG + Intergenic
1139319316 16:66100589-66100611 GAATCGCTTGAACCCGGTGGAGG + Intergenic
1139415673 16:66807124-66807146 CAGTTGCTTGAGCCTGGGGGTGG - Intronic
1139586332 16:67906448-67906470 GAGTCACTTGAACCTGGTGGAGG - Intronic
1139613870 16:68077472-68077494 GAATCACTTGAACCTGGAGGCGG - Intronic
1139655143 16:68382930-68382952 GAATCGCTTGAGCCCAGTGGGGG - Intronic
1139839071 16:69863549-69863571 GAATTGCTTGAACCTGGTGGGGG + Intronic
1140441490 16:74991424-74991446 GAGTCCCCTTGGCCTGGGGGAGG + Intronic
1140801553 16:78492847-78492869 GTGTCCCTTGAGCCTGGAGACGG + Intronic
1141180550 16:81750330-81750352 GAATCCCTTGAACCTGGGAGGGG + Intronic
1141201044 16:81897876-81897898 ATGTCCCTTGAGCTGGGTGGAGG + Intronic
1141953583 16:87354878-87354900 GAGTCACTTGAACCGGGAGGTGG + Intronic
1142939142 17:3366970-3366992 GATTACCTTGAGACTGGTGTAGG + Intergenic
1143105517 17:4528562-4528584 GAATCGCTTGAACCTGGTGGTGG - Intronic
1143140035 17:4736903-4736925 GAATCACTTGAACCTGGAGGCGG - Intronic
1143339400 17:6198352-6198374 GAATCACTTGAACCTGGAGGCGG - Intergenic
1143455004 17:7061604-7061626 GAATCACTTGAACCTGGAGGTGG - Intergenic
1143469911 17:7166463-7166485 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1143499495 17:7330464-7330486 GAGTCCCTAGGGGCTGCTGGCGG + Intergenic
1143605771 17:7984809-7984831 GAATCACTTGAACCTGGAGGCGG - Intergenic
1143651662 17:8267220-8267242 GTGCCCCGTGAGCCTGGTGAGGG + Exonic
1143979607 17:10857349-10857371 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1144096445 17:11904539-11904561 GAACCACTTGAACCTGGTGGAGG + Intronic
1144123319 17:12177995-12178017 GAATCCCTTGAACCTGGGAGGGG + Intergenic
1144306547 17:13973759-13973781 GAATTGCTTGAACCTGGTGGAGG - Intergenic
1144446238 17:15332089-15332111 GAATCGCTTGAACCTGGTGGCGG + Intronic
1145082200 17:19903301-19903323 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1145808100 17:27749066-27749088 CACACCCTTGGGCCTGGTGGGGG + Intergenic
1145844257 17:28024026-28024048 GAATCACTTGAACCTGGTGGGGG + Intergenic
1145940218 17:28739534-28739556 GATTCGCTTGAACCCGGTGGTGG - Intronic
1146120735 17:30191721-30191743 GAATCAGTTGAGCCTGGTCGAGG + Intergenic
1146471935 17:33131668-33131690 GAGTCCTGTGAGGCTGGAGGAGG + Intronic
1146670466 17:34733965-34733987 GAATCACTTGAGCCGGGTGGCGG + Intergenic
1146844343 17:36173843-36173865 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1146856648 17:36261778-36261800 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1146863969 17:36326597-36326619 GGCTCCCTTGACCCTGGCGGGGG + Intronic
1146872558 17:36385689-36385711 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1146879916 17:36436774-36436796 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1146941677 17:36847803-36847825 GAATCGCTTGAACCTGCTGGAGG - Intergenic
1146984561 17:37203047-37203069 GAATCGCTTGAACCTGGGGGCGG - Intronic
1147066829 17:37927185-37927207 GGCTCCCTTGACCCTGGCGGGGG + Intronic
1147075442 17:37986313-37986335 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1147078361 17:38006746-38006768 GGCTCCCTTGACCCTGGCGGGGG + Intronic
1147086967 17:38065859-38065881 GGCTCCCTTGACCCTGGCGGGGG - Intronic
1147094299 17:38130681-38130703 GGCTCCCTTGACCCTGGCGGGGG + Intergenic
1147102912 17:38189822-38189844 GGCTCCCTTGACCCTGGCGGGGG - Intergenic
1147141247 17:38461704-38461726 GAGTCCCTTGAGCCTGGGGAAGG + Intronic
1147219378 17:38919564-38919586 GGGTCCCTGGAGACTGGGGGTGG - Exonic
1147247387 17:39131438-39131460 GAATCGCTTGAACCTGGAGGTGG - Intronic
1147279636 17:39348371-39348393 GAATCCCTTGAACCTGGGAGCGG + Intronic
1147290830 17:39441680-39441702 GAATCTCTTGAACCCGGTGGGGG + Intronic
1147795304 17:43037886-43037908 TTGTTCCTAGAGCCTGGTGGCGG - Intergenic
1149636929 17:58178447-58178469 GAATCGCTTGAACCTGGGGGTGG + Intergenic
1149872682 17:60197091-60197113 GAATCACTTGAACCTGGAGGTGG + Intronic
1149888073 17:60360569-60360591 GAATTGCTTGAGCCTGGAGGTGG + Intronic
1149895956 17:60428572-60428594 GAATCGCTTGAACCTGGAGGTGG - Intronic
1150280111 17:63925216-63925238 GAATCTTTTGAACCTGGTGGAGG - Intergenic
1150323700 17:64238210-64238232 GAATCGCTTGACCCTGGAGGTGG + Intronic
1150494640 17:65597838-65597860 GAATCGCTTGAACCTGGAGGCGG - Intronic
1150542542 17:66118040-66118062 GAGCCCCTAGACACTGGTGGTGG + Intronic
1150858127 17:68772785-68772807 AAGTCCCTAGAGGCAGGTGGGGG + Intergenic
1150915807 17:69435753-69435775 GAATCACTTGAACCTGGTGGAGG - Intronic
1151786136 17:76275935-76275957 GAGGTCCCTGAGCCTGATGGGGG + Exonic
1151848281 17:76673390-76673412 GGGTCACCTGCGCCTGGTGGAGG - Exonic
1152505512 17:80747127-80747149 GAATCGCTTGAACCTGGAGGTGG + Intronic
1152913246 17:83017533-83017555 GAATCACTTGAACCTGGAGGTGG + Intronic
1153061883 18:1003577-1003599 GAGTCCTTTGTTCCTGATGGAGG + Intergenic
1153303734 18:3614007-3614029 GAATCGCTTGAACCTGGGGGCGG - Intronic
1153303870 18:3615006-3615028 GAATCACTTGAACCTGGAGGCGG - Intronic
1153562239 18:6383158-6383180 GAGACACTTGAGCTTGGTTGGGG - Intronic
1153801527 18:8675402-8675424 GAATCACTTGAACCTGGGGGCGG - Intergenic
1154249825 18:12735103-12735125 GAATCACTTGAGCCTGGAGGCGG + Intergenic
1154534303 18:15382801-15382823 GAGTGCTTTGAGCCCAGTGGTGG + Intergenic
1155223981 18:23712290-23712312 GAATCGCTTGAACCTGGGGGCGG + Intronic
1155800319 18:30093343-30093365 GAATCACTTGAACCTGGAGGTGG + Intergenic
1155971231 18:32085611-32085633 GAATCGCTTGAACCTGGGGGTGG + Intergenic
1156013630 18:32522820-32522842 GAGTTGCTTGAACCTGGTGGAGG + Intergenic
1157433535 18:47650419-47650441 GATTCCCTTAAGCTGGGTGGGGG - Intergenic
1157666840 18:49494374-49494396 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1158740435 18:60135769-60135791 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1158812715 18:61056274-61056296 GAATCGCTTGAACCTGGGGGAGG + Intergenic
1158999653 18:62961206-62961228 GAGTCACTTGAACCTGGGGGCGG + Intronic
1159939799 18:74398129-74398151 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1160658821 19:288832-288854 GAGTCCCTGGAGCCTGCTCAGGG + Intronic
1160917850 19:1506269-1506291 GGGTCTCCTGGGCCTGGTGGTGG + Exonic
1161114723 19:2490209-2490231 GAATCGCTTGAGCCTGGGAGGGG - Intergenic
1161214569 19:3087298-3087320 GAATCACTTGAGCCCGGAGGTGG + Intergenic
1161664112 19:5564663-5564685 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1161989056 19:7673624-7673646 GAATCACTTGAACCTGGAGGTGG - Intergenic
1161998350 19:7728501-7728523 CAGGCCCTTGAGGCAGGTGGGGG - Intergenic
1162012744 19:7828236-7828258 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1162154623 19:8669029-8669051 GAATCACTTGAGCCTGGAGATGG - Intergenic
1162291179 19:9781863-9781885 GAATCCCTTGAACCCGGAGGCGG - Intronic
1162982949 19:14250464-14250486 GAATCCCTTGAACCGGGAGGCGG + Intergenic
1163004186 19:14387281-14387303 AAGGGCCATGAGCCTGGTGGGGG - Intronic
1163063297 19:14775458-14775480 AAGGGCCATGAGCCTGGTGGGGG + Intronic
1163122331 19:15225495-15225517 GAATCGCTTGAGCCTGGGAGGGG + Intergenic
1163134439 19:15299460-15299482 GAGTCCCTTGGTGGTGGTGGTGG + Intronic
1163316989 19:16547380-16547402 GACTCACTTGAGTCTGGAGGTGG + Intronic
1163330964 19:16637415-16637437 GGATCGCTTGAGCCTGGGGGAGG + Intronic
1163757598 19:19115737-19115759 GAATCACTTGAACCTGGAGGTGG - Intergenic
1163842846 19:19621839-19621861 GAATCGCTTGAACCTGGAGGGGG + Intergenic
1163965769 19:20746066-20746088 GAATCACTTGAACCTGGAGGCGG - Intronic
1164116254 19:22222190-22222212 GAATCACTTGAGCCAGGAGGTGG - Intergenic
1164208011 19:23073792-23073814 GAATCCCTTGAACCTGGGAGAGG + Intergenic
1164368578 19:27618173-27618195 GAGTGCCTTGAGGCCTGTGGTGG + Intergenic
1164716724 19:30396690-30396712 GAATCACTTGAACCTGGCGGCGG - Intronic
1164809955 19:31147917-31147939 GGGTCTCTGGAGCCTGGAGGTGG + Intergenic
1164994975 19:32714362-32714384 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1165028978 19:32983712-32983734 GAATCACTTGAACCTGGAGGTGG - Intronic
1165157080 19:33795564-33795586 GCGTCCCTGGAGCCAGGCGGGGG + Intergenic
1165165804 19:33854965-33854987 GGATCGCTTGAGCCTGGGGGCGG - Intergenic
1165323401 19:35099952-35099974 CAGGCCCTTGAACCTGATGGTGG - Intergenic
1165380703 19:35477683-35477705 GAATCGCTTGAACCCGGTGGAGG - Intergenic
1165883028 19:39056928-39056950 GAATCACTTGAACCTGGTGGGGG - Intergenic
1166070646 19:40385374-40385396 GAGACCCTTGTGGCTGGAGGAGG - Intronic
1166134879 19:40770103-40770125 GAATCACTTGAACCTGGAGGTGG + Intergenic
1166410868 19:42554731-42554753 GTGTCCCTTCAGCCTGGGTGTGG - Intronic
1166502324 19:43351155-43351177 GAATCACTTGAAGCTGGTGGTGG - Intergenic
1166507781 19:43382306-43382328 GAATCACTTGAAGCTGGTGGTGG + Intergenic
1166546401 19:43636743-43636765 GTGTCCCCAGAGCCTGGGGGTGG - Intronic
1166712202 19:44944804-44944826 GAGTCGCTGGAGCCTGGTGAGGG + Exonic
1166724904 19:45021085-45021107 GAATCCCTTGAGCCCGGAGGCGG + Intronic
1166843678 19:45713368-45713390 GCCTGCCCTGAGCCTGGTGGCGG - Exonic
1167439322 19:49499420-49499442 GAGAGCCTTTAGCCTGGTGAAGG + Intronic
1167686666 19:50960851-50960873 GAATCACTTGAACCTGGAGGCGG - Intronic
1167974110 19:53210150-53210172 GGGACACTTGAGCTTGGTGGGGG - Intergenic
1168308250 19:55447831-55447853 GTGTCCATGGAGCCTGGCGGAGG - Intergenic
1168483541 19:56741206-56741228 GAATCACTTGAGCCTGGAGGCGG - Intergenic
925269791 2:2595802-2595824 GAATCACTTGAACCTGGAGGTGG + Intergenic
925480843 2:4272367-4272389 GAGACCCTTGAGCCTCCTTGAGG - Intergenic
925578047 2:5380946-5380968 GAGTCGCTTGAACCAGGTGACGG + Intergenic
925729156 2:6905003-6905025 GGGACACTTGAGCTTGGTGGCGG - Intergenic
927543864 2:23935962-23935984 GAATCCCTTGAACCTGGGAGGGG + Intronic
927778377 2:25919949-25919971 GAATCGCTTGAACCTGGAGGCGG - Intergenic
928021259 2:27706829-27706851 GAATCCCTTGAACCAGGAGGTGG - Exonic
928054926 2:28043216-28043238 GAATCCCTTGAACCAGGAGGAGG - Intronic
928181608 2:29072255-29072277 GGATGCCTTGAGCCTGCTGGTGG + Exonic
928219440 2:29391386-29391408 GAATCGCTTGAGCCAGGAGGCGG - Intronic
928783688 2:34855176-34855198 GAGCCACTTAAGTCTGGTGGTGG - Intergenic
929120204 2:38477917-38477939 GAGGCCGTTGAGCTTGGTGGAGG - Intergenic
929192053 2:39149073-39149095 GAATCGCTTGAACCTGGAGGCGG - Intergenic
929218592 2:39440610-39440632 GAATCACTTGAGCCGGGAGGTGG + Intergenic
929255230 2:39803084-39803106 GAATCACTTGAGCCTGGAGGCGG + Intergenic
929585577 2:43112185-43112207 GAGTGTCTTGAGCTTGGTTGTGG - Intergenic
930050521 2:47212181-47212203 GAATCGCTTGAACCTGGGGGCGG + Intergenic
931327119 2:61237981-61238003 GAATCGCTTGAACCTGGAGGTGG - Intronic
931453508 2:62388335-62388357 GGATTCCTTGAGCCTGGAGGCGG - Intergenic
931818748 2:65930742-65930764 GAGTTCCTAGAGCCTGGAGGTGG + Intergenic
932026028 2:68133663-68133685 GAACCCCTTGAACCTGGAGGTGG + Intronic
932818845 2:74882390-74882412 GAGTAAGTTGAGGCTGGTGGAGG + Intronic
933727798 2:85436418-85436440 GAGTCCCATGAGCCTCATGCTGG - Intronic
935082707 2:99814248-99814270 AAGTCCTTTGAGGGTGGTGGTGG - Intronic
935105383 2:100038808-100038830 GAATCGCTTGAACCCGGTGGCGG - Intronic
935732549 2:106076228-106076250 GAACCGCTTGAACCTGGTGGGGG + Intronic
936142548 2:109952731-109952753 GAATCGCTTGAGCTTGGAGGTGG + Intergenic
936179236 2:110250696-110250718 GAATCGCTTGAGCTTGGAGGTGG + Intergenic
936202140 2:110418740-110418762 GAATCGCTTGAGCTTGGAGGTGG - Intronic
936238821 2:110769745-110769767 GAATCCCTTGAACCAGGAGGCGG + Intronic
936586143 2:113759616-113759638 GAATCTCTTGAACCTGGGGGTGG + Intergenic
936672627 2:114675885-114675907 GAATCACTTGAACCTGGAGGTGG - Intronic
937143136 2:119618879-119618901 GGGACACTTGAGCTTGGTGGGGG + Intronic
937465019 2:122124978-122125000 GAGACACTTGAGCTTGGTGTGGG - Intergenic
937664295 2:124467232-124467254 GAGGCCCTAGAGCCTGGTTGAGG + Intronic
938558563 2:132449332-132449354 GAATCCCTTGAACCTTGAGGCGG - Intronic
938965887 2:136388084-136388106 GAATCGCTTGAACCTGGAGGCGG + Intergenic
939167916 2:138659168-138659190 GAATCGCTTGAGCCCGGAGGCGG - Intergenic
939498577 2:142952162-142952184 GAATCGCTTGAGCCTGGGGAAGG - Intronic
939512765 2:143127049-143127071 GAATCACTTGAACCTGGAGGCGG + Intronic
939617297 2:144375665-144375687 GAATCGCTTGAACCTGGAGGCGG + Intergenic
940054530 2:149500061-149500083 GGGACACTTGAGCTTGGTGGGGG - Intergenic
940530985 2:154875419-154875441 GAATCTCTTGAACCTGGGGGTGG + Intergenic
940946502 2:159623987-159624009 GGGACACTTGAGCTTGGTGGGGG + Intergenic
941004351 2:160232446-160232468 GAGTCACTTGAACCTGGTGGTGG + Intronic
941126065 2:161584890-161584912 GAATCACTTGAACCTGGAGGAGG + Intronic
941712824 2:168732339-168732361 CAGTCCCTTGCACCTGGTGCTGG + Intronic
941864059 2:170315391-170315413 GAATCACTTGAACCTGGAGGCGG - Intronic
942055109 2:172174755-172174777 GAATCACTTGAACCTGGTGGTGG + Intergenic
942309967 2:174647044-174647066 GGGTACTTTGAGCCTGGAGGTGG + Intronic
942403009 2:175623090-175623112 GAATCGCTTGAACCTGGGGGTGG + Intergenic
942658918 2:178243738-178243760 GAATCGCTTGAACCTGGAGGCGG - Intronic
942953686 2:181750386-181750408 GGGACCCTGGAGCTTGGTGGGGG - Intergenic
943074643 2:183179387-183179409 GAGATGCTTGAGCTTGGTGGGGG - Intergenic
943375527 2:187071960-187071982 GAATCGCTTGAACCTGGAGGCGG + Intergenic
943562182 2:189477246-189477268 GAGTCCCTTTCTACTGGTGGTGG + Intergenic
944084832 2:195833840-195833862 GAATCGCTTGAACCTGGAGGTGG - Intronic
944189041 2:196981690-196981712 GAATCGCTTGACCCTGGAGGTGG + Intronic
944334565 2:198515807-198515829 GAATCGCTTGAACCTGGGGGTGG + Intronic
945790546 2:214299335-214299357 GAATCGCTTGAACCTGGAGGTGG - Intronic
945815912 2:214604738-214604760 GAATCGCTTGAACCTGGGGGCGG - Intergenic
945950046 2:216030628-216030650 GAATCGCTTGAACCTGGGGGCGG - Intronic
945958271 2:216106318-216106340 AAATCGCTTGAGCCTGGTGGCGG + Intergenic
946278101 2:218645847-218645869 GAATCGCTTGAGCCGGGGGGTGG - Intronic
947603387 2:231468272-231468294 CAGGCCCCTGAGCCTGCTGGAGG + Intronic
948484261 2:238270660-238270682 TAGTCCCTGGAGCCAGCTGGGGG - Intronic
948589869 2:239042195-239042217 GGGTGCCCTGAGGCTGGTGGAGG - Intergenic
948666285 2:239536561-239536583 GAGTCTGTTGAGCTGGGTGGAGG - Intergenic
948770070 2:240247305-240247327 GTGTCCCCTGATCCTGCTGGAGG + Intergenic
948890311 2:240904188-240904210 GAATCACTTGAACCTGGTGGGGG + Intergenic
948907626 2:240987243-240987265 GAGTCCCTGGAGCCTGAGGAGGG + Intronic
949015397 2:241706539-241706561 GAATCACTTGAACCTGGAGGCGG + Intronic
1169857400 20:10118236-10118258 GAATCACTTGAACCCGGTGGGGG - Intergenic
1171401788 20:24878116-24878138 CAGTGCCTTGTGCCAGGTGGTGG - Intergenic
1171825842 20:29903542-29903564 GAGTGCCTTGAGGCTTATGGTGG + Intergenic
1171954449 20:31449679-31449701 GAGTCCCTTGAACTGGGAGGAGG + Intronic
1172164362 20:32889912-32889934 GAATCGCTTGAACCTGGAGGTGG + Intronic
1173091523 20:39976637-39976659 GAATGGCTTGAGCCTGGTAGGGG - Intergenic
1173494419 20:43508317-43508339 CAGTCCCGGGAGGCTGGTGGCGG + Intronic
1173515676 20:43663985-43664007 GAATCACTTGAACCTGGAGGCGG - Intergenic
1173999975 20:47367475-47367497 GAATCGCTTGAACCTGGTAGGGG + Intergenic
1174360546 20:50026468-50026490 GAATCACTTGAACCTGGAGGCGG + Intergenic
1174446888 20:50596558-50596580 GAGTCACCTGAGCCTTGGGGAGG - Intronic
1174556135 20:51396991-51397013 GAATCGCTTGAACCTGGAGGCGG - Intronic
1174696791 20:52567910-52567932 GAGTCGCTTGAACCTGGATGGGG - Intergenic
1174823499 20:53747632-53747654 GAATCTCTTGAACCTGGTAGGGG - Intergenic
1175883878 20:62277161-62277183 GAATCACTTGAACCTGGAGGCGG + Intronic
1176148499 20:63576261-63576283 GAATCCCTTGAACCTGGGGTCGG + Intergenic
1177168871 21:17633469-17633491 GAGTCACTTGAGCTGGGCGGAGG + Intergenic
1177185441 21:17788497-17788519 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1177667958 21:24186146-24186168 GGATCACTTGAGCCAGGTGGTGG + Intergenic
1177754393 21:25328039-25328061 GAATCACTTGAACCTGGGGGCGG + Intergenic
1178593869 21:33935461-33935483 GAATCCCTTGAACCAGGAGGTGG - Intergenic
1178867538 21:36342138-36342160 GAGTCGCTTGAACCTGCAGGTGG + Intronic
1179513343 21:41889718-41889740 GAATCGCTTGAACCTGGAGGTGG - Intronic
1180009791 21:45041666-45041688 GAGTCCCTTGGGGCTGGGGCAGG - Intergenic
1180142965 21:45903498-45903520 GCATCCCTGGGGCCTGGTGGTGG + Intronic
1180680503 22:17622877-17622899 GAATCACTTGAACCTGGAGGCGG + Intronic
1181471629 22:23144004-23144026 GAATCGCTTGAGCCGGGAGGCGG + Intronic
1181525605 22:23483827-23483849 GAATCCCTCGAACCTGGAGGCGG + Intergenic
1181771526 22:25129133-25129155 GAGTGCCATGAGGATGGTGGCGG + Intronic
1182272230 22:29162028-29162050 GAATCACTTGAACCTGGAGGTGG + Intronic
1182537240 22:31013701-31013723 GAATCACTTGAACCTGGAGGCGG + Intergenic
1182604728 22:31494394-31494416 GAATCGCTTGAACCTGGTGGGGG - Intronic
1182952489 22:34390658-34390680 GGGACCCTTGAGCTTGGTGGGGG - Intergenic
1183100756 22:35582633-35582655 CAGCCTCTTGAGGCTGGTGGAGG + Intergenic
1183528584 22:38339188-38339210 GACTCCCTTTAGCCCAGTGGGGG - Intronic
1183890103 22:40920278-40920300 GAATCGCTTGAACCCGGTGGGGG + Intronic
1184361063 22:44019002-44019024 GAATCGCTTGAACCTGGAGGTGG - Intronic
1184660726 22:45964421-45964443 GACTCCCCTCAGCCTGGGGGGGG - Intronic
1185357000 22:50379407-50379429 GTATCACTTGAGCCTGGAGGTGG + Intronic
949377657 3:3407861-3407883 GTGACACTTGAGCTTGGTGGGGG + Intergenic
950108057 3:10400867-10400889 GAGTCCCTTCAGCCTCATGAAGG + Intronic
950151918 3:10694245-10694267 GAGTACCTTGATAGTGGTGGTGG - Intronic
950311743 3:11964970-11964992 GAATCCCTTGGACCTGGAGGTGG - Intergenic
950361980 3:12456008-12456030 GTGTCCATGGAGACTGGTGGAGG - Intergenic
950667919 3:14508442-14508464 GAGTGACCTGAGCCAGGTGGAGG + Intronic
951849249 3:27120408-27120430 GAATCCCTTGAGCATGGAGGTGG - Intronic
951871421 3:27366896-27366918 GAATCCCTTGAACCGGGAGGCGG - Intronic
952142400 3:30494499-30494521 GAATCACTTGAACCTGGAGGTGG - Intergenic
952224299 3:31358424-31358446 GAATCGCTTGAGCCCAGTGGGGG + Intergenic
952539685 3:34354754-34354776 GGATCTCTTGAGCCTGATGGTGG + Intergenic
953202813 3:40792570-40792592 GGGTCGCTTAGGCCTGGTGGTGG + Intergenic
953667636 3:44937354-44937376 GAATCGCTTGAGCCTGGGGTGGG + Intronic
953766293 3:45746436-45746458 GAGTCCCTGGAGCCTGCTGCAGG + Intergenic
953988013 3:47460643-47460665 GAATCGCTTGAACCTGGGGGCGG - Intronic
954056952 3:48034614-48034636 GAATCGCTTGAACCTGGAGGGGG + Intronic
954119943 3:48491734-48491756 GAATTGCTTGAGCTTGGTGGGGG - Intronic
954262596 3:49450245-49450267 GAATCCCTTGAACCTGGGAGGGG + Intergenic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
954994145 3:54866328-54866350 TGGTCCCTTGAGCCTTGGGGAGG + Intronic
955171630 3:56571467-56571489 GAATCGCTTGAGCCTGGGAGGGG - Intronic
955317491 3:57951002-57951024 GAATCGCTTGAACCTGGAGGTGG + Intergenic
955915532 3:63904378-63904400 GAATCGCTTGAACCTGGCGGGGG - Intronic
956395270 3:68819181-68819203 GAACCACTTGAGCCTGGAGGCGG + Intronic
956437162 3:69245432-69245454 GAATCGCTTGAACCTGGAGGTGG - Intronic
957249666 3:77757037-77757059 GAGATGCTTGAGCTTGGTGGGGG + Intergenic
957386182 3:79500215-79500237 GAATCGCTTGAACCTGGAGGCGG - Intronic
957526703 3:81387503-81387525 GAATCACTTGAACCTGGGGGCGG - Intergenic
959761345 3:109969267-109969289 GAATCCCTTGAACCTGGGGGTGG + Intergenic
959763335 3:109994883-109994905 GAATCGCTTGAACCTGGAGGCGG - Intergenic
959767519 3:110049043-110049065 GAATCGCTTGAACCTGGAGGTGG + Intergenic
959801728 3:110502903-110502925 GAATCACTTGAACCTGGAGGGGG + Intergenic
960004545 3:112768344-112768366 GAATCGCTTGAACCTGGAGGCGG + Intronic
961489900 3:127247931-127247953 GAGTCCATTCATCCTGTTGGAGG + Intergenic
961684670 3:128621405-128621427 GGATCGCTTGAGCCTGGAGGTGG + Intronic
961722313 3:128905056-128905078 GAATCACTTGAACCCGGTGGGGG + Intronic
962448137 3:135487038-135487060 GGATCATTTGAGCCTGGTGGAGG + Intergenic
962552308 3:136507451-136507473 GGATCACTTGAGCCTGGTGGGGG - Intronic
962634776 3:137319434-137319456 GGGACGCTTGAGCTTGGTGGGGG - Intergenic
962863287 3:139424694-139424716 GAATCACTTGAACCTGGAGGCGG - Intergenic
963356516 3:144215005-144215027 GAATCACTTGAACCTGGAGGCGG - Intergenic
963694860 3:148553729-148553751 GTGTCCCATGTGCTTGGTGGAGG + Intergenic
963847233 3:150171607-150171629 AAGTCCCCTGAGCCTGGTCCAGG - Intergenic
963895148 3:150677581-150677603 GGATCCCTTGAGCCTGGGGGTGG - Intronic
964263559 3:154868807-154868829 GAATCACTTGAGCCTGGAGGGGG + Intergenic
964451780 3:156820031-156820053 GAATCACTTGAACCTGGAGGCGG - Intergenic
964566177 3:158055576-158055598 GAATGGCTTGAGCCTGGAGGCGG + Intergenic
965237073 3:166137526-166137548 GAATTGCTTGAGCCTGGGGGTGG + Intergenic
965583593 3:170295122-170295144 GAATCACTTCAGCCTGGAGGCGG + Intronic
966112441 3:176419186-176419208 GAATCCCTTGAACCGGGAGGTGG + Intergenic
966189297 3:177257454-177257476 GAATCGCTTGAACCTGGCGGAGG - Intergenic
966209316 3:177436269-177436291 GAATCGCTTGAACCTGGGGGCGG + Intergenic
966561451 3:181325086-181325108 GAGTTTCTTGAGCTTGGTTGGGG - Intergenic
966894633 3:184434668-184434690 GAATCACTTGAACCTGGAGGCGG - Intronic
966901783 3:184491933-184491955 GAATCGCTTGAACCTGGAGGCGG + Intronic
967195754 3:187024179-187024201 GAATCACTTGAACCTGGAGGCGG - Intronic
967374945 3:188790732-188790754 GAGTCGCTTGAACCAGGAGGTGG + Intronic
967852553 3:194093293-194093315 GGGGCCCTTGAGCCTGGAGGCGG + Intergenic
968109723 3:196034657-196034679 GAATCGCTTGAACCTGGAGGCGG + Intronic
968114525 3:196079524-196079546 GAATCACTTGAACCTGGGGGAGG + Intronic
968145489 3:196294820-196294842 GAATTGCTTGAACCTGGTGGCGG - Intronic
968297824 3:197591247-197591269 GAATCCCTTGAACCTGGGAGGGG - Intergenic
968502094 4:955573-955595 GAGGCCCGTGTGCGTGGTGGTGG + Intronic
968630866 4:1650581-1650603 GAATCGCTTGAACCTGGAGGCGG - Intronic
968744543 4:2352934-2352956 GGGGCCCTGGAGCCTGGAGGAGG - Intronic
968853965 4:3104519-3104541 GAATCGCTTGAACCTGGGGGTGG + Intronic
969080352 4:4612956-4612978 GAATCACTTGAGCCTGGGAGTGG + Intergenic
969344318 4:6561795-6561817 GACTCCCTAGAGCCTGCTTGCGG - Intronic
969784315 4:9442005-9442027 GATTCACTTGAACCTGGAGGTGG + Intergenic
970583393 4:17493345-17493367 GGTTCACTTGAGCCTGGGGGAGG + Intronic
970787296 4:19814479-19814501 GAATCACTTGAACCTGGAGGCGG + Intergenic
971172752 4:24250181-24250203 GAGTTCCTCGAGCCTGGGTGTGG - Intergenic
971277242 4:25209937-25209959 GGGTCCATTCAGCCTGTTGGGGG + Intronic
972088166 4:35245871-35245893 GAATCCCTTGAACCTGTCGGGGG + Intergenic
972485357 4:39534951-39534973 GAATCACTTGAACCTGGAGGCGG + Intergenic
972532817 4:39976799-39976821 GAGCCCCGTGAGCCTGGGGCTGG - Intronic
973225529 4:47779521-47779543 GAATCACTTGAACCTGGGGGCGG - Intronic
973666518 4:53164702-53164724 GAATCACTTGAACCTGGAGGTGG + Intronic
973788231 4:54354724-54354746 GAATCGCTTGAACCTGGAGGTGG + Intergenic
973820623 4:54658757-54658779 GACTCCCGCGAGCCTGGAGGTGG + Intronic
974458245 4:62155977-62155999 GAATTGCTTGAACCTGGTGGGGG + Intergenic
975138489 4:70897381-70897403 GAATCACTTGAACCTGGAGGTGG + Intergenic
975653679 4:76619972-76619994 GAATTACTTGAACCTGGTGGAGG + Intronic
976254363 4:83084643-83084665 GAATCGCTTGAACCTGGAGGCGG - Intergenic
976812304 4:89110820-89110842 GAGACCCTTGAGCCAGTGGGAGG - Intronic
977284608 4:95087113-95087135 GAATCACTTGAGCCTGGAGGCGG - Intronic
977344756 4:95803660-95803682 TAGCCCCTTCAGCCTGGAGGGGG + Intergenic
977534937 4:98246194-98246216 GAATCGCTTGAACCTGGAGGTGG + Intergenic
977599872 4:98924678-98924700 GAATCGCTTGAACCTGGAGGTGG - Intronic
978441516 4:108739020-108739042 GAGTCCATTGTGCCTGTTGTGGG - Intergenic
978566274 4:110085586-110085608 GAGTCCCTGGACTCTGGTGAGGG + Intronic
978954018 4:114594015-114594037 GTGGCCCTTGAGCCTGGTTAGGG + Intergenic
979479311 4:121197438-121197460 GAATCGCTTGAGCTTGGTGGCGG + Intronic
979612012 4:122699197-122699219 GAATCGCTTGAGCCGGGAGGTGG + Intergenic
979808807 4:125009754-125009776 GAATCGCTTGAACCTGGAGGCGG + Intergenic
980047469 4:128004821-128004843 GAATCACTTGAGCCCGGAGGTGG + Intronic
980100311 4:128535711-128535733 GGGACGCTTGAGCTTGGTGGGGG - Intergenic
980298719 4:130959369-130959391 GAATCACTTGAACCTGGTTGCGG - Intergenic
980777123 4:137451825-137451847 GAGTCCCTTCAGTCAGTTGGGGG + Intergenic
981012710 4:139942045-139942067 GAGTCACTTGAACCGGGAGGCGG + Intronic
981480444 4:145233192-145233214 GAATCGCTTGAACCTGGAGGCGG + Intergenic
981996926 4:150985169-150985191 GAATCACTTGAACCTGGGGGTGG + Intronic
982064945 4:151646143-151646165 GAGGCCCATGAGCATAGTGGAGG + Intronic
982298960 4:153859579-153859601 GAGATCCTTAAGCTTGGTGGGGG - Intergenic
983557952 4:169075130-169075152 GAATCACTTGAACCTGGAGGCGG + Intergenic
983966663 4:173820693-173820715 GAATCGCTTGAACCTGGAGGCGG + Intergenic
984038887 4:174704205-174704227 GGATCGCTTGAGCCTGGAGGTGG + Intronic
984535342 4:180968271-180968293 GAGTCCTTTAAGCCAGGTAGGGG - Intergenic
984724432 4:183006998-183007020 GAATCCCTTGAACCTGGGAGGGG + Intergenic
985102893 4:186475710-186475732 GAATCACTTGAACCTGGGGGTGG - Intronic
985588761 5:754157-754179 GTTTCCCCTGAGCATGGTGGAGG - Intronic
985588767 5:754196-754218 GTTTCCCCTGAGCATGGTGGAGG - Intronic
985588836 5:754585-754607 GTTTCCCCTGAGCATGGTGGAGG - Intronic
985603444 5:846674-846696 GTTTCCCCTGAGCATGGTGGAGG - Intronic
985603452 5:846713-846735 GTTTCCCCTGAGCATGGTGGAGG - Intronic
985990178 5:3551038-3551060 GAATCACTTGAACCTGGGGGCGG - Intergenic
988101739 5:26688301-26688323 GAATCGCTTGAACCTGGAGGAGG + Intergenic
988488382 5:31686449-31686471 GAATCGCTTGAACCTGGAGGTGG - Intronic
988503360 5:31801375-31801397 CAGCATCTTGAGCCTGGTGGTGG - Intronic
988518149 5:31922764-31922786 GAGTCACTTGAGCCCGGAGGGGG - Intronic
988581213 5:32470644-32470666 GAATCGCTTGAACCTGGGGGCGG - Intergenic
988826206 5:34937880-34937902 GAATCACTTGAACCTGGAGGCGG - Intronic
989365137 5:40647428-40647450 GAATCACTTGAACCTGGAGGCGG + Intergenic
989854652 5:46267827-46267849 GAGTGCATTGAGCCTTATGGAGG - Intergenic
989859235 5:46345325-46345347 GAGTGCTTTGAGCCTTATGGTGG - Intergenic
990183766 5:53191182-53191204 GGGACACTTGAGCTTGGTGGGGG - Intergenic
990490723 5:56300523-56300545 GAATCACTTGACCCTGGAGGCGG - Intergenic
991192401 5:63889710-63889732 GAATCGCTTGAACCTGGGGGAGG - Intergenic
991397748 5:66222694-66222716 GGGACACTTGAGCTTGGTGGGGG - Intergenic
991585354 5:68196412-68196434 GAATCACTTGAACCTGGCGGGGG - Exonic
991685368 5:69176889-69176911 GAATCACTTGAACCTGGGGGCGG + Intronic
991771454 5:70044887-70044909 GAATCACTTGACCCTGGAGGCGG - Intergenic
991850745 5:70920305-70920327 GAATCACTTGACCCTGGAGGCGG - Intergenic
991906700 5:71521098-71521120 GAATCGCTTGAACCTGGAGGCGG + Intronic
992051338 5:72943793-72943815 GAATCCCTTGAACCTAGGGGGGG - Intergenic
992714980 5:79501472-79501494 TTGTCCCTTGAACATGGTGGGGG - Intronic
993255717 5:85588074-85588096 GGGACACTTGAGCATGGTGGGGG - Intergenic
993644467 5:90445508-90445530 GCATCCCTTGAGCCAGGAGGCGG - Intergenic
993658475 5:90601148-90601170 GAATCACTTGAACCTGGCGGTGG + Intronic
994084703 5:95744981-95745003 GGATCACTTGAGCCTGGGGGAGG + Intronic
994320914 5:98393286-98393308 GAGTCCCCTTAACCTGGAGGTGG - Intergenic
995201909 5:109434571-109434593 GAATCGTTTGAGCCTGGGGGTGG + Intergenic
995793841 5:115921993-115922015 GAATCACTTGAACCTGGAGGTGG - Intergenic
995903318 5:117094266-117094288 GAGTCCAGTGAGCTTGGTGTGGG - Intergenic
996270780 5:121602345-121602367 GAGACTCTTGAGCTTGGTGGGGG + Intergenic
996712530 5:126557497-126557519 GAATCACTTGAACCTGGAGGTGG + Intronic
996718170 5:126604350-126604372 GAATCCCTTGAGCGAGGAGGCGG - Intronic
996722449 5:126643237-126643259 GAATCGCTTGAACCTGGAGGCGG - Intergenic
997240830 5:132306531-132306553 GAGTTGCTTGAGCCTGGAGGTGG - Intronic
997252292 5:132398419-132398441 GGGACTCTTGAGCTTGGTGGTGG + Intergenic
997332645 5:133077323-133077345 GAATCGCTTGAACCTGGGGGTGG - Intronic
997423185 5:133785409-133785431 GGTTCCCTGGAGCCTGATGGGGG - Intergenic
997985319 5:138496713-138496735 GAATCTCTTGAACCTGGAGGTGG - Intergenic
998035935 5:138915959-138915981 GAATCGCTTGAGCCTGGGAGAGG + Intronic
998094082 5:139387627-139387649 GAGTGCCCTGAGGCTGGAGGAGG + Exonic
998428155 5:142047359-142047381 GAGTCACTTGAACCTAGAGGCGG + Intergenic
998447317 5:142208459-142208481 GAATCACTTGAACCTGGAGGTGG - Intergenic
998974070 5:147625065-147625087 GAATCGCTTGAACCTGGAGGCGG - Intronic
999264034 5:150255027-150255049 GAGGCCTTTGAGCCAGGCGGAGG - Intronic
999488717 5:152026854-152026876 GAGACACTTGAGCTTGGTAGGGG - Intergenic
999535605 5:152513509-152513531 GAATCGCTTGAACCTGGGGGCGG - Intergenic
999712519 5:154331320-154331342 GAGGCCTATGAGCCTGCTGGTGG + Intronic
1000153837 5:158530895-158530917 GAATCGCTTGAGCCTGGGAGGGG + Intergenic
1000727586 5:164790735-164790757 AAATCCCTTGAACCTGGAGGAGG + Intergenic
1000966779 5:167667185-167667207 AAGGCCCTTGAGTCTGGAGGTGG + Intronic
1001733059 5:173974192-173974214 GAGTCCCAAGAGGCTGGTGGTGG + Intronic
1001828926 5:174768801-174768823 GAATCACTTGAACCTGGTGGAGG + Intergenic
1002046651 5:176545209-176545231 GAATCGCTTGAACCTGGAGGTGG - Intronic
1002163048 5:177328184-177328206 GAGCACCCGGAGCCTGGTGGAGG - Intergenic
1002670812 5:180864994-180865016 GAATCCCTTGAACCTGGGAGGGG - Intergenic
1002911614 6:1495156-1495178 GAGTCCCTTAAGTCTGGAGAAGG - Intergenic
1002990478 6:2233730-2233752 GACTCTCTTGATCCCGGTGGGGG + Intronic
1003154090 6:3576519-3576541 GAATCACTTGAACCTGGAGGCGG + Intergenic
1003793467 6:9573803-9573825 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1004327384 6:14687800-14687822 GAGTCGCTTGAACCAGGAGGCGG - Intergenic
1004337472 6:14777303-14777325 GAATCACTTGAACCTGGAGGCGG + Intergenic
1004618504 6:17313145-17313167 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1004900672 6:20190856-20190878 GAGTCCCCTGTCCCTGGTGGTGG - Intronic
1004910020 6:20273781-20273803 GAATCGCTTGAACCTGGGGGTGG + Intergenic
1004967804 6:20874600-20874622 GAATCGCTTGAACCTGGAGGCGG - Intronic
1005036721 6:21562011-21562033 GAATCGCTTGAACCTGGGGGTGG - Intergenic
1005619891 6:27610066-27610088 GAATCGCTTGAACCTGATGGGGG + Intergenic
1006155008 6:32009193-32009215 GAGTCCCCTGGGCAGGGTGGAGG + Intergenic
1006161319 6:32041928-32041950 GAGTCCCCTGGGCAGGGTGGAGG + Exonic
1006659544 6:35628803-35628825 GAATCACTTGAGCCTGGGAGTGG - Intronic
1006744116 6:36329722-36329744 GAATCACTTGACCCTGGAGGAGG + Intronic
1007100801 6:39245025-39245047 GAATCCCTTGAACCCGGAGGTGG + Intergenic
1007104330 6:39273194-39273216 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1007134594 6:39508635-39508657 GAGACGCTGGAGCTTGGTGGGGG + Intronic
1007265336 6:40591400-40591422 GAGTCCCTTGGGCCTAGGGGAGG - Intergenic
1007410720 6:41659741-41659763 GACTCCCTTGAACCCGGCGGAGG + Intergenic
1007477121 6:42126166-42126188 GAATCGCTTGAACCTGGAGGCGG - Intronic
1007677395 6:43608041-43608063 GAATCGCTTGAACCTGGAGGTGG + Intronic
1007798644 6:44372547-44372569 GAATCCCTTGAACCTAGGGGCGG - Intronic
1008561267 6:52727203-52727225 GAATCGCTTGAGCCAGGAGGTGG - Intergenic
1009755669 6:67936963-67936985 GAGTCACTTGAACCCGGAGGTGG - Intergenic
1010155651 6:72789242-72789264 GAATCCCTTGAACCTAGAGGCGG - Intronic
1010422825 6:75693315-75693337 GAATCACTTGAACCTGGAGGTGG + Intronic
1010423966 6:75705455-75705477 GAATCACTTGAACCTGGGGGCGG + Intronic
1010659305 6:78550441-78550463 GAATCACTTGAGCCAGGGGGAGG - Intergenic
1010906410 6:81495598-81495620 GAATCGCTTGAACCTGGAGGTGG + Intronic
1011120090 6:83942756-83942778 GGGACACTTGAGCCTGGTGGGGG + Intronic
1011174103 6:84541114-84541136 GAGACATTTGAGCTTGGTGGGGG + Intergenic
1011702055 6:89964970-89964992 GAATCGCTTGAACCTGGAGGCGG - Intronic
1011933426 6:92742165-92742187 GAATCACTTGAACGTGGTGGGGG + Intergenic
1012167617 6:95977836-95977858 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1014066659 6:117134908-117134930 TTGTCCCTTGAGGCTGGAGGTGG - Intergenic
1014188013 6:118457846-118457868 GAATCGCTTGAGCCAGGAGGTGG - Intergenic
1014188035 6:118458019-118458041 GAATCGCTTGAGCCGGGAGGTGG - Intergenic
1014282353 6:119455824-119455846 CAGTCCCTTGAGGCTGTTGCTGG - Intergenic
1014836549 6:126166961-126166983 GGGACACTTGAGCTTGGTGGGGG - Intergenic
1015121586 6:129706797-129706819 GAATCACTTGAGCCTGGAGACGG + Intronic
1015548966 6:134392463-134392485 GGGTCACTTGGGCCTGGAGGTGG - Intergenic
1016933470 6:149431022-149431044 GAATCACTTGAACCTGGTGGGGG - Intergenic
1017153756 6:151304662-151304684 GAATCACTTGAACCTGGAGGTGG - Intronic
1017326035 6:153142344-153142366 GAATCGCTTGAGCCTGGGAGCGG + Intergenic
1017345970 6:153381342-153381364 GAATTGCTTGAGCCCGGTGGGGG - Intergenic
1017510444 6:155110034-155110056 GAGTCCCTTGAACCCAGAGGTGG - Intronic
1017519322 6:155187664-155187686 GAATCCCTTGAACCAGGAGGTGG - Intronic
1018637046 6:165871807-165871829 GAGTGCTTTGATCCTGGGGGTGG + Intronic
1018734499 6:166677446-166677468 GGGTTGCTTGAGCCTGGAGGAGG - Intronic
1019728949 7:2619746-2619768 GAATCGCTTGAGCCCGGAGGCGG - Intergenic
1020074893 7:5251452-5251474 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1021037349 7:15816390-15816412 GAATCACTTGAACCTGGAGGCGG + Intergenic
1021127911 7:16875026-16875048 GAATCGCTTGAACCTGGGGGTGG + Intronic
1021278320 7:18684168-18684190 GAGTCACTTGAGCCTGGAGGCGG + Intronic
1021724463 7:23535787-23535809 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1021727033 7:23557516-23557538 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1022030225 7:26486040-26486062 GAGGCTCTTCATCCTGGTGGAGG - Intergenic
1022058848 7:26770302-26770324 GGGACACTTGAGCTTGGTGGGGG - Intronic
1022107374 7:27206061-27206083 GAGTCCCTGGAGCCAGACGGAGG - Intergenic
1022720780 7:32940531-32940553 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1023249001 7:38237460-38237482 GAATCACTTGAACCTGGAGGTGG + Intergenic
1023289545 7:38655423-38655445 GAGCCCCCTGAACCTGGAGGTGG + Intergenic
1023785799 7:43706458-43706480 GAATCACTTGAGCCAGGAGGCGG + Intronic
1023924167 7:44653178-44653200 GAATCACTTGAACCTGGAGGTGG - Intronic
1025183334 7:56836629-56836651 GAATCACTTGAGCCTGGGGGCGG - Intergenic
1025204220 7:56982369-56982391 GAATCACTTGAACCTGGAGGTGG + Intergenic
1025243142 7:57294731-57294753 GAGTCACTTGAGCCTTGAGGGGG - Intergenic
1025523407 7:61771575-61771597 GAGTGCATTGAGGCTTGTGGTGG - Intergenic
1025667720 7:63594564-63594586 GAATCACTTGAACCTGGAGGTGG - Intergenic
1025688593 7:63740337-63740359 GAATCACTTGAGCCTGGGGGCGG + Intergenic
1026005236 7:66595350-66595372 GAATCGCTTGAACCTGGGGGTGG - Intergenic
1026567122 7:71498387-71498409 GAATCACTTGAGCCTGGTGGAGG + Intronic
1026851759 7:73728509-73728531 GAATCGCTTGAACCTGGAGGTGG + Intergenic
1026860295 7:73782543-73782565 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1027027893 7:74867650-74867672 GAATCGCTTGAGCCAGGAGGTGG + Intergenic
1027059855 7:75076421-75076443 GAATCGCTTGAGCCAGGAGGTGG - Intergenic
1027141769 7:75662591-75662613 GAGTCACTTGAACCTGGGAGAGG - Intronic
1027201974 7:76069629-76069651 GGGTCCCTGGAGCCTGCTGCTGG + Intergenic
1027809961 7:82883855-82883877 GAATAGCTTGAGCCTGGAGGCGG - Intronic
1028969105 7:96837137-96837159 GAATCGCTTGAACCTGGTGGAGG + Intergenic
1029208764 7:98887641-98887663 GAATCACTTGAACCTGGAGGCGG + Intronic
1029521183 7:101063531-101063553 GAATCACTTGAGCCTGTTGGGGG + Intergenic
1029605992 7:101599680-101599702 GAGTCCCGGGGGCCTGGAGGAGG - Intergenic
1029836726 7:103319945-103319967 GAATCGCTTGAACCTGGAGGCGG + Intronic
1029845252 7:103406026-103406048 GGGACGCTTGAGCTTGGTGGGGG - Intronic
1030041609 7:105455958-105455980 GAGTCACTTGAACCTGGTAGTGG + Intronic
1030269452 7:107654679-107654701 GAATCACTTGAACCTGGAGGCGG + Intergenic
1030686114 7:112488682-112488704 GAATCGCTTGAACCTGGAGGTGG - Intronic
1030705632 7:112690011-112690033 GGGACACTTGAGCTTGGTGGAGG - Intergenic
1032009813 7:128337643-128337665 GAATCGCTTGAACCTGGAGGCGG - Intronic
1032067763 7:128784401-128784423 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1032604057 7:133330269-133330291 GGGACACTTGAGCTTGGTGGGGG - Intronic
1032659749 7:133970192-133970214 GGGACACTTGAGCTTGGTGGGGG - Intronic
1033201813 7:139379654-139379676 GAATCACTTGAACCTGGAGGCGG - Intronic
1033373220 7:140731101-140731123 GGATCCCTTGAACCTGGGGGCGG - Intronic
1033947976 7:146745677-146745699 GAATCGCTTGACCCTGGAGGTGG + Intronic
1034520702 7:151617172-151617194 GAATCACTTGAACCTGGAGGCGG + Intronic
1034842188 7:154409054-154409076 GAATCACTTGAGCCTGGGAGGGG + Intronic
1035434051 7:158844707-158844729 GAATCGCTTGAACCTGGAGGTGG - Intergenic
1035566403 8:644005-644027 GAGTCCTGTGGGCTTGGTGGGGG + Intronic
1035714263 8:1741913-1741935 GAGTCCCTTGACCGTGCTGCAGG + Intergenic
1036386230 8:8284187-8284209 GAATCGCTTGAACCTGGGGGCGG + Intergenic
1036633047 8:10528965-10528987 GAGGCCCTTGAGAGGGGTGGAGG - Intronic
1036834727 8:12052133-12052155 GATTCACTTGAACCTGGAGGTGG - Intergenic
1036856570 8:12298697-12298719 GATTCACTTGAACCTGGAGGTGG - Intergenic
1037134989 8:15449696-15449718 GAGTCCTTTCAGTCTGCTGGGGG + Intronic
1037530629 8:19769333-19769355 GAATCCCTTGAACCTGGGGGAGG + Intergenic
1038184693 8:25262904-25262926 GAATCACTTGAACCTGGAGGTGG - Intronic
1038580509 8:28744704-28744726 GAATCACTTGAACCTGGAGGCGG + Intronic
1038887084 8:31675252-31675274 GAATCACTTGAACCTGGAGGTGG + Intronic
1039284564 8:36026669-36026691 GGGACGCTTGAGCTTGGTGGGGG + Intergenic
1039334899 8:36577951-36577973 GAATCACTTGAGCCTGGGGAGGG - Intergenic
1039700398 8:39956144-39956166 GACTCTCTTGAGCCAGGAGGTGG - Intronic
1039719804 8:40151045-40151067 GAGTCACTTGAACCAGGAGGCGG + Intergenic
1039956387 8:42210258-42210280 GAATTGCTTGAACCTGGTGGAGG - Intergenic
1040044833 8:42952115-42952137 GAGACCCCTGAGCCTGGAGCTGG - Intronic
1040058552 8:43083983-43084005 GAGTTGCTTGAACCTGGAGGTGG + Intronic
1040502437 8:48016871-48016893 GAATCGCTTGAACCTGGAGGTGG - Intronic
1040637882 8:49296687-49296709 GAGTCGCTTGAACCTGGAGGTGG + Intergenic
1041088830 8:54282990-54283012 GAATCCCTTGAACCTGGAGAAGG - Intergenic
1041454286 8:58041026-58041048 GAATCACTTGAACCTGGAGGCGG - Intronic
1041993483 8:64024958-64024980 GAATCACTTGAACCTGGAGGTGG - Intergenic
1042141113 8:65679533-65679555 GAATCACTTGAACCTGGAGGGGG + Intronic
1042553391 8:70014019-70014041 GGATCCCTTCAGCCTGGAGGTGG + Intergenic
1043852578 8:85231621-85231643 GAATCGCTTGAACCTGGAGGCGG - Intronic
1044869209 8:96601844-96601866 GAATCACTTGAACCTGGAGGTGG - Intronic
1044870646 8:96616663-96616685 GAATCGCTTGAACCTGGTGGGGG - Intergenic
1044940252 8:97334987-97335009 GGGACACTTGAGCTTGGTGGGGG - Intergenic
1044973925 8:97644936-97644958 GAGACCCTCGAGCTTGGGGGAGG + Intronic
1045082996 8:98648802-98648824 GAATCACTTGAACCTGGAGGCGG + Intronic
1045133452 8:99184901-99184923 GAGTCTCTTGAACCTGGAGGCGG + Intronic
1045186086 8:99839634-99839656 CAGTGGCTTGAGCCTGGTGTAGG - Intronic
1045262986 8:100593539-100593561 GAATCCCTTGAGTCTGGGAGGGG - Intronic
1045624120 8:104022467-104022489 GAATCCCTTGAGCCGGGAGGGGG - Intronic
1046111686 8:109733352-109733374 GGGTCTCTTTAGCCTGTTGGTGG + Intergenic
1046130968 8:109968436-109968458 GTGTCCCTTGTGCATGGTGGTGG - Exonic
1047372080 8:124264644-124264666 GAATCTCTTGAACCTGGGGGCGG - Intergenic
1047378055 8:124322906-124322928 GAATCCCTTGAACCTGGAGGTGG + Intronic
1048538921 8:135324658-135324680 CAGTGCCTTGGGACTGGTGGTGG + Intergenic
1048667734 8:136682295-136682317 CAGTACCTTGACTCTGGTGGTGG - Intergenic
1048674935 8:136768481-136768503 GAATCACTTGAACCTGGAGGTGG - Intergenic
1048750581 8:137669347-137669369 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1048882116 8:138879602-138879624 GAATCCTTTGAGCCGGGAGGTGG + Intronic
1049041166 8:140112925-140112947 GAATCCCTTGAACCAGGAGGCGG - Intronic
1049067221 8:140326439-140326461 GGGTCCTTTGATCATGGTGGGGG - Intronic
1049114815 8:140676849-140676871 GAATTGCTTGAACCTGGTGGGGG + Intronic
1049228096 8:141467294-141467316 CAGGTCCTTGAGCCTGATGGGGG - Intergenic
1049343214 8:142124822-142124844 GGGTCCCCTGAGGCTGGAGGAGG + Intergenic
1049389493 8:142360629-142360651 GGCTCCCTTCAGGCTGGTGGGGG - Intronic
1049564600 8:143331638-143331660 GAGGCCCTAGAGCCTGGGAGAGG - Intronic
1049862382 8:144908484-144908506 GAACCCCTTGAACCTGGAGGTGG + Intergenic
1050102338 9:2131850-2131872 GAATCACTTGAACCTGGAGGTGG + Intronic
1050432261 9:5573926-5573948 GAATCACTTGAACCTGGTGGGGG - Intergenic
1051640893 9:19223599-19223621 GAATCACTTGAACCTGGAGGCGG + Intergenic
1051647803 9:19287466-19287488 AGATCACTTGAGCCTGGTGGGGG - Intronic
1052584466 9:30408455-30408477 GAGTCGCTTGAACCGGGAGGCGG + Intergenic
1052620249 9:30899405-30899427 GGGTCCCTTGAGCCAGTGGGTGG - Intergenic
1052867642 9:33474541-33474563 GAATCGCTTGAGCCTGGGAGAGG - Intergenic
1052911220 9:33883626-33883648 GGATCACTTGAGCCTGGAGGTGG + Intronic
1053191097 9:36069451-36069473 GAATCACTTGAACCTGGAGGTGG + Intronic
1053235762 9:36452618-36452640 GAGTCGCTTGAACCAGGAGGTGG - Intronic
1053461520 9:38274905-38274927 GAGTCCATTGACCCAGGAGGAGG + Intergenic
1053715329 9:40883114-40883136 GAGTGCCTTGAGCCTTATTGTGG + Intergenic
1054989530 9:71306784-71306806 GAATCGCTTGAACCTGGGGGTGG + Intronic
1055314477 9:75020353-75020375 GAGTCGCTTGAACCTGGGAGGGG - Intronic
1055560831 9:77519920-77519942 GAATCACTTGAACCTGGAGGCGG + Intronic
1056216170 9:84408126-84408148 GAATCCCTTGAACCCGGGGGCGG + Intergenic
1056281499 9:85045508-85045530 GAATCACTTGAACCGGGTGGCGG - Intergenic
1056302630 9:85257996-85258018 GAGGCACTGGAGCTTGGTGGGGG - Intergenic
1056492359 9:87120144-87120166 GAATCACTTGAACCTGGGGGTGG + Intergenic
1057397844 9:94695933-94695955 GAATCACTTGAACCTGGAGGCGG - Intergenic
1057588942 9:96355104-96355126 GAATCGCTTGAGCCAGGAGGCGG - Intronic
1057748192 9:97769253-97769275 GACTCACTTGACCCTGTTGGGGG - Intergenic
1057791474 9:98127724-98127746 GAATCACTTGAACCTGGGGGTGG + Intronic
1057928823 9:99176022-99176044 GAGTCACTTGAACCTGGAAGGGG - Intergenic
1057991755 9:99777438-99777460 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1058295445 9:103300994-103301016 AAGTCCCACAAGCCTGGTGGGGG - Intergenic
1058867826 9:109177733-109177755 GAATCGCTTGAACCTGGGGGCGG + Intronic
1058912716 9:109535592-109535614 GAATCACTTGAACCTGGAGGCGG - Intergenic
1059210352 9:112509286-112509308 GAATCGCTTGAACCTGGGGGAGG - Intronic
1059222420 9:112637463-112637485 GAGTCGCTTGAAACTGGAGGAGG - Intronic
1059805076 9:117790023-117790045 GAGGCCCTTGAGACAGCTGGCGG - Intergenic
1059870715 9:118571019-118571041 GGATCCCTTGAGCCTAGGGGTGG + Intergenic
1060395743 9:123315203-123315225 GAGTCGCTTGAACCAGGAGGCGG - Intergenic
1060533775 9:124366314-124366336 GAATCGCTTGAACCTGGAGGTGG + Intronic
1060621953 9:125075651-125075673 GAATCACTTGAACCTGGAGGCGG - Intronic
1060717171 9:125943266-125943288 GAATCACTTGAGCCTAGAGGTGG + Intronic
1061115048 9:128604841-128604863 GAATCACTTGAACCCGGTGGGGG + Intronic
1061328848 9:129879887-129879909 GTGTCCCTTGTTCCTGGGGGTGG - Intronic
1061331234 9:129894968-129894990 GAATCGCTTGAACCTGGGGGAGG + Intronic
1061660955 9:132129991-132130013 GAGTCCCTTGGTCCTGATAGGGG + Intergenic
1061751449 9:132780350-132780372 CAGCCCCTTGTGCCTGGGGGTGG + Intronic
1061760779 9:132849831-132849853 GAATCGCTTGAACCTGGAGGAGG - Intronic
1061767304 9:132889491-132889513 GAATCGCTTGAACCTGGAGGTGG - Intronic
1062510452 9:136902451-136902473 GCATCCCATGAGCCTGGAGGTGG - Intronic
1062583797 9:137240008-137240030 GAATCGCTTGAACCTGGGGGGGG + Intergenic
1062609793 9:137368819-137368841 GCGCCCCATGGGCCTGGTGGAGG - Intronic
1062619527 9:137413587-137413609 GAATCACTTGAGCCAGGAGGCGG - Intronic
1062712799 9:137985896-137985918 GTGTCCCTTGTCCCTGGTGAGGG + Intronic
1203396819 Un_KI270519v1:26286-26308 GAGTCCTTTGAGGCCTGTGGAGG - Intergenic
1185472352 X:391645-391667 GAATCGCTTGAACCCGGTGGAGG + Intergenic
1185601031 X:1339398-1339420 GAGCCCCTTGAGGCTGGGGACGG - Intronic
1185743637 X:2554100-2554122 GAATCACTTGAACCTGGAGGCGG + Intergenic
1185874409 X:3690642-3690664 GGATCACTTGAGCCTGGGGGCGG + Intronic
1186220163 X:7341897-7341919 GAATCGCTTGAACCTGGAGGTGG - Intronic
1186274768 X:7927318-7927340 GAGTCCCTTTAACCAGATGGCGG + Exonic
1186539238 X:10383255-10383277 CAGTCCCTTCAGCCTGGAGGAGG + Intergenic
1187319389 X:18226489-18226511 GATGCCCATGTGCCTGGTGGGGG + Intergenic
1187562014 X:20412207-20412229 GAATCGCTTGAGCCAGGAGGTGG - Intergenic
1187950367 X:24465082-24465104 GAGTCCCATGAGCCAGGGAGGGG + Intergenic
1187952234 X:24482294-24482316 GAATCACTTGAACCTGGAGGTGG - Intronic
1188592964 X:31862218-31862240 GAATCCCTTGAACCTGGAGGCGG - Intronic
1188605549 X:32024395-32024417 GAATCACTCGAACCTGGTGGGGG + Intronic
1188690433 X:33122136-33122158 GAATTGCTTGAGCCTGGAGGTGG + Intronic
1189189639 X:39089098-39089120 GGGACACTTGAGCTTGGTGGGGG + Intergenic
1189479760 X:41383569-41383591 TAGTCCCTTCAGCCTGGGGGTGG + Intergenic
1189480083 X:41385651-41385673 GAGTTGCTTGAACCTGGGGGAGG + Intergenic
1190028323 X:46947105-46947127 GAATCACTTGAGCCTGGGAGGGG - Intronic
1190043247 X:47089103-47089125 GAATCACCTGAGCCTGGGGGAGG + Intronic
1190291861 X:48998431-48998453 GAAGCTCTTGAGGCTGGTGGGGG + Intronic
1190327978 X:49218458-49218480 GAGTCCCTTGGCCCTGTTGATGG + Exonic
1190385146 X:49878051-49878073 TAGTCCCCTAATCCTGGTGGTGG - Intergenic
1191007333 X:55723642-55723664 GAATCCCTTGAACCAGGAGGTGG - Intronic
1191112015 X:56811603-56811625 GGGACCCTGGAGCTTGGTGGGGG - Intergenic
1191119744 X:56890915-56890937 GAGATGCTTGAGCTTGGTGGGGG + Intergenic
1191601770 X:63016755-63016777 GGGACACTTGAGCTTGGTGGGGG - Intergenic
1191962490 X:66718901-66718923 GAGATGCTTGAGCTTGGTGGGGG + Intergenic
1192604961 X:72506933-72506955 GGATCACTTGAGCCTGGTGGAGG - Intronic
1192778634 X:74271136-74271158 GAATCACTTGAGCCGGGAGGCGG + Intergenic
1194295095 X:92117346-92117368 GACTCACTTGAACCTGGGGGTGG + Intronic
1194841931 X:98753790-98753812 GAATCCCTTTGGACTGGTGGTGG - Intergenic
1194868415 X:99097696-99097718 GAATCGCTTGAGCCTGGGAGGGG + Intergenic
1195130471 X:101845820-101845842 GAGTCACTTTAGGCTGGTAGTGG + Intronic
1196090092 X:111731438-111731460 GAGTCCCATGAGTATGTTGGGGG - Intronic
1196439773 X:115707898-115707920 GGATCCCTTGAGCCTGGGTGGGG + Intergenic
1196814670 X:119655354-119655376 GAGTCACTGGGGCCTGGGGGTGG - Intronic
1197221062 X:123914536-123914558 GAATTGCTTGAGCCTGGAGGTGG - Intergenic
1197538455 X:127723421-127723443 GAATCGCTTGAGCCTGGGAGGGG - Intergenic
1197584467 X:128328125-128328147 GAATCACTTGAACCCGGTGGGGG - Intergenic
1197766491 X:130062577-130062599 GAATCCCTTGAACCTGGAGGTGG - Intergenic
1197880750 X:131164258-131164280 GAGACACTCGAGCTTGGTGGGGG - Intergenic
1198030540 X:132749772-132749794 TAGTCACTGCAGCCTGGTGGGGG + Intronic
1198268524 X:135032731-135032753 GAGACCCTCGGGCCTGGGGGCGG + Exonic
1198270443 X:135051739-135051761 GAGACCCTTGGGCCTGGGGGCGG - Exonic
1198402896 X:136284878-136284900 GAATCGCTTGAACCTGGAGGCGG + Intergenic
1198798399 X:140424383-140424405 GAGACTCTTGAGGCTGGAGGAGG + Intergenic
1198881926 X:141291314-141291336 GAATCGCTTGAACCTGGAGGCGG - Intergenic
1199353904 X:146837861-146837883 GAATCACTTGAACCTGGGGGTGG - Intergenic
1200130714 X:153843028-153843050 GAATCCCTTGAACCGGGAGGCGG + Intergenic
1200444715 Y:3246564-3246586 GAATCACTTGAACCTGGTGAAGG - Intergenic
1200986720 Y:9308753-9308775 GAATCCATTGAACCTGGTGATGG + Intergenic