ID: 1107730089

View in Genome Browser
Species Human (GRCh38)
Location 13:43339871-43339893
Sequence GGAATATTAATGCAGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107730085_1107730089 6 Left 1107730085 13:43339842-43339864 CCAAAATGTGATTCCTGTGGTAT 0: 1
1: 2
2: 0
3: 16
4: 173
Right 1107730089 13:43339871-43339893 GGAATATTAATGCAGACAAATGG 0: 1
1: 0
2: 1
3: 26
4: 318
1107730087_1107730089 -7 Left 1107730087 13:43339855-43339877 CCTGTGGTATTTGCCAGGAATAT 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1107730089 13:43339871-43339893 GGAATATTAATGCAGACAAATGG 0: 1
1: 0
2: 1
3: 26
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107730089 Original CRISPR GGAATATTAATGCAGACAAA TGG Intronic
900526440 1:3131243-3131265 GCAAAATAAATGCAGACAACTGG - Intronic
901010358 1:6198090-6198112 GGAATGTTAGGGCAAACAAAAGG - Intronic
902907066 1:19566181-19566203 GGAAGATTACTGCTGTCAAAGGG + Intergenic
904341996 1:29841688-29841710 TGAACATGAATGTAGACAAAAGG + Intergenic
905426486 1:37889293-37889315 GAAATATTTGTGGAGACAAATGG - Intronic
906093937 1:43207251-43207273 GGAATGTAAGTGCAGACCAAGGG - Intronic
908257664 1:62316237-62316259 GTAATAATATTGCAGGCAAAGGG + Intronic
908493136 1:64666573-64666595 GGATTGTTAATGAAGAAAAACGG + Intronic
909732276 1:78908078-78908100 GGAATATTAAAGGGGACAGAGGG + Intronic
909764644 1:79340335-79340357 CTAATATTAATGGAGAAAAATGG + Intergenic
910655572 1:89614896-89614918 AGAATAATAATGCAGAGAAAGGG - Intergenic
910921570 1:92353898-92353920 GGAAAATTAATGTAGAAAATTGG - Intronic
911198183 1:95017173-95017195 GGATAATTGAAGCAGACAAAAGG + Intronic
911441289 1:97928942-97928964 GGAATATCAATGCAGACAGAGGG - Intergenic
911518118 1:98894075-98894097 GGCATATTAAACCACACAAAAGG + Intronic
913466700 1:119150239-119150261 TGCATAATAAAGCAGACAAAAGG - Intergenic
915709636 1:157883438-157883460 GGGAACTTATTGCAGACAAAGGG + Intronic
917470785 1:175324207-175324229 AGAAAAATAATGCAGACAATGGG - Intronic
919026827 1:192182601-192182623 TGAATATTTATCCATACAAATGG + Intronic
920769825 1:208872329-208872351 GAAATGTTATTGAAGACAAAAGG - Intergenic
921436496 1:215129593-215129615 GAAAGATTAATGAAGGCAAAGGG + Intronic
923026887 1:230211486-230211508 ATAAAATTAATGCACACAAAAGG - Intronic
923069237 1:230547726-230547748 CAAAGAATAATGCAGACAAAGGG - Intergenic
923583695 1:235245100-235245122 AAAGTATGAATGCAGACAAAAGG - Intronic
924276400 1:242391824-242391846 GGAATACTAAAACATACAAAAGG + Intronic
924422248 1:243920504-243920526 TAAATGTTAATGCAGACAGAAGG - Intergenic
924949494 1:248869124-248869146 GCAATATTAATACAGGTAAAAGG + Intergenic
1064126108 10:12662153-12662175 GGAATTTGAATGAAGACACATGG + Intronic
1064304021 10:14149227-14149249 GGCATATTAAAGGAGACATATGG - Intronic
1064634730 10:17352854-17352876 AGTATATTAATGCTGAAAAATGG + Intronic
1064835675 10:19527062-19527084 GGAAAATTACTGCACACAGATGG - Intronic
1066157496 10:32693710-32693732 AGAAAATTCATGCAGACACAGGG - Intronic
1066431349 10:35354745-35354767 GGATTTTTCATGGAGACAAAGGG + Intronic
1067255906 10:44640809-44640831 GGAATTTTAATACAGAGAACTGG - Intergenic
1068838834 10:61587604-61587626 GTAATGTTAATGCAAAGAAAAGG - Intergenic
1070245122 10:74723582-74723604 AAAATATGAATGGAGACAAATGG + Intergenic
1071006289 10:80887875-80887897 GGAACAGAAAAGCAGACAAATGG + Intergenic
1071092717 10:81937757-81937779 GCAATAGTAAAACAGACAAATGG - Intronic
1071339085 10:84626113-84626135 GGAGTAGTAATCCAGACAAGGGG + Intergenic
1071489527 10:86126896-86126918 GGGATATTAAGGCAGACAGCAGG - Intronic
1072182025 10:92993303-92993325 GGAATATAAATAAAGAAAAATGG + Intronic
1072983841 10:100122291-100122313 GGGAAATGAATCCAGACAAAAGG + Intergenic
1073433132 10:103499761-103499783 AGAATGTGAATGCAGAAAAATGG - Intronic
1073877595 10:107943426-107943448 GCAATATGAATGCCGAGAAAGGG - Intergenic
1074990959 10:118707292-118707314 GGAATTTCAAAGCAGAAAAAGGG + Intronic
1077058344 11:606721-606743 GGGAAATCAATGCAGAAAAATGG - Intronic
1077948200 11:6925938-6925960 GGAATAGGACTGCAGAGAAAGGG - Intergenic
1078651311 11:13196555-13196577 GGAAGAAGAATGCAGGCAAATGG + Intergenic
1079509702 11:21196626-21196648 GGAAAAATAAAGCAGAGAAAGGG - Intronic
1080074910 11:28137716-28137738 GAAATATTTTTGAAGACAAATGG - Intronic
1080646070 11:34188608-34188630 GGAAATTTAATGCACAAAAAGGG + Intronic
1080850897 11:36068961-36068983 GGAATATAAATACAGAAAGAAGG - Intronic
1081331561 11:41806887-41806909 TGAATATTAATGAAGGCAAATGG + Intergenic
1083075659 11:60034407-60034429 GGGATATTAAAACATACAAATGG + Intergenic
1083838757 11:65290730-65290752 GGAATATTAGTTTATACAAAAGG - Intronic
1083927144 11:65814860-65814882 GGAAGATTAATGCGAACAACAGG - Intergenic
1086631524 11:89025408-89025430 GAAAGGTTAATGCAGACATAAGG + Intronic
1086675324 11:89599284-89599306 GGTATATAAATACAAACAAAAGG + Intergenic
1087328205 11:96748671-96748693 GGAATATTATTCCTGAGAAAGGG - Intergenic
1087740910 11:101885689-101885711 GTAATATTAAAGCATATAAAAGG - Intergenic
1087957140 11:104302543-104302565 GGAAAATGTATGCTGACAAATGG - Intergenic
1088205632 11:107388833-107388855 GGAATTTTAATGCAGAAAGAAGG - Intronic
1088996341 11:115001173-115001195 GGAATATTCATGCTTACAAAAGG - Intergenic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1092965257 12:13635180-13635202 GGAATATTAATGCTGAGAGGAGG + Intronic
1093728075 12:22538952-22538974 GAAAAATTAATGCAGGAAAAGGG - Intronic
1093953251 12:25188421-25188443 GGAAAATTAATGAACACACATGG - Intronic
1094425466 12:30312333-30312355 GGAAAATTTATTCAAACAAATGG + Intergenic
1095446815 12:42290441-42290463 GTTATATGAATGCAAACAAAGGG + Intronic
1095479911 12:42624264-42624286 GGTATATTATAGCAGAGAAAGGG + Intergenic
1095519819 12:43050335-43050357 TAAATGTTAATGCAGACATAAGG + Intergenic
1095663212 12:44762371-44762393 GGAATTTTAATGGTGAGAAATGG - Intronic
1096204522 12:49709578-49709600 GGAAGAATTATCCAGACAAAGGG + Intronic
1096929503 12:55190975-55190997 GGAATATTAATTCAGTCACATGG - Intergenic
1097788033 12:63782735-63782757 TGAATATTCATTCACACAAAGGG - Intronic
1098593962 12:72248980-72249002 TTCATATTAATGGAGACAAAGGG + Intronic
1099261897 12:80393225-80393247 GGAATATTACTACAAAGAAACGG - Intergenic
1099619720 12:84986870-84986892 GAAATATTGATCCAGACAACTGG + Intergenic
1100679703 12:96906379-96906401 GCAATATGAATGCAGATAACTGG + Intergenic
1101066071 12:101022244-101022266 GGATGACTAATGCAGAGAAATGG - Intronic
1103673049 12:122633901-122633923 GGAAAATTTATGAAGAAAAAAGG - Intergenic
1105888836 13:24667326-24667348 GGACTATTAATGCATAAGAAGGG - Intergenic
1107147446 13:37073675-37073697 GGAGTTTTTATGCAGCCAAAGGG - Intergenic
1107415962 13:40200358-40200380 GGAAAATTATTCCAGGCAAAAGG - Intergenic
1107730089 13:43339871-43339893 GGAATATTAATGCAGACAAATGG + Intronic
1109505565 13:63298038-63298060 AGAATAATTATGCAGAAAAATGG + Intergenic
1109712299 13:66177628-66177650 GGAATATCTTTACAGACAAAGGG + Intergenic
1110077797 13:71271254-71271276 AGAATATTAATGTGAACAAATGG - Intergenic
1110353984 13:74544733-74544755 GGAATATCTCTGCAAACAAATGG + Intergenic
1113236974 13:108287916-108287938 AGAATGTTAATCCAGAGAAATGG + Intronic
1113848754 13:113406280-113406302 GAAATATCAATGCAGAAGAAGGG - Intergenic
1114908441 14:27161314-27161336 GTATTATTAATGCAGATAACTGG + Intergenic
1115289370 14:31752801-31752823 GGATAATTAATGAAGAAAAAAGG + Intronic
1116521557 14:45854084-45854106 GGAAAATTTATGAAGACAGAAGG - Intergenic
1116685179 14:48029954-48029976 GGAAAATTGATGCAAACAAAAGG - Intergenic
1117071898 14:52065162-52065184 GGAATATCCATGGAGAAAAAGGG + Intronic
1118598646 14:67455337-67455359 GGAAGAATACTGCAGACAGAGGG - Intronic
1119488177 14:75006121-75006143 GGAACAATGATGCAGAAAAAAGG - Intronic
1119692674 14:76689591-76689613 GGAATATTATTACAGTCACAGGG + Intergenic
1120388687 14:83878489-83878511 GGAATATTAAAGCAGAGGAAGGG - Intergenic
1122426796 14:101614296-101614318 TGGAAATTAATGGAGACAAAAGG + Intergenic
1125061269 15:35427952-35427974 GGAATTTCACTGCAGACAAGAGG + Intronic
1125340287 15:38668803-38668825 CAAATATTAAGGCAGACAGATGG - Intergenic
1125519639 15:40340621-40340643 GGAATCTTGATGCAGAGACATGG - Intronic
1125782256 15:42280223-42280245 GGAAAATTACTCCAGAAAAATGG - Intronic
1126050363 15:44679690-44679712 GGAATAAAAAGGGAGACAAAGGG - Intronic
1126527792 15:49677071-49677093 GGAATATAGCTGCAGATAAATGG + Intergenic
1127381129 15:58431368-58431390 GGAACATTAATGAACACAGAGGG + Intronic
1127634207 15:60853657-60853679 GGAATATTAATGGAACCACATGG - Intronic
1128270118 15:66301826-66301848 AGAATATTAATGCAGAAAGCAGG - Intronic
1128499337 15:68216589-68216611 GGAATATTTAAGGAGAAAAAAGG - Intronic
1130628503 15:85540581-85540603 GGAGTACTGATGCAGAGAAAAGG + Intronic
1134699303 16:16251814-16251836 GAAACATTAATACAGATAAAAGG - Intronic
1135692419 16:24552131-24552153 GGGATGTTTATTCAGACAAAAGG - Intronic
1137410683 16:48225409-48225431 GGCATAGAAATGCAGACAAGGGG - Intronic
1138928389 16:61620149-61620171 AGAATCTTAATTCAGACAACAGG - Intergenic
1139220714 16:65178799-65178821 GGAAGATGAATGAAGAGAAAAGG + Intergenic
1140586893 16:76303268-76303290 GGAATTTTCCTGCAGATAAATGG - Intronic
1140884751 16:79233212-79233234 GGAATATCAATGCACAGAATGGG + Intergenic
1141258413 16:82426534-82426556 GGAGTATTTAAACAGACAAAAGG - Intergenic
1141386301 16:83625030-83625052 GGAATATTTAAGCACAAAAATGG + Intronic
1142469095 17:152804-152826 AAAATAATAGTGCAGACAAAAGG + Intronic
1142844904 17:2666241-2666263 GGCATATTATTGCAGATACATGG + Intronic
1142902934 17:3024715-3024737 GGAATATTATTGCAGTAAAAAGG + Intronic
1144222582 17:13113345-13113367 GGAATTTTAACCCAGAGAAAGGG - Intergenic
1144605394 17:16660743-16660765 GGAATCTTAAAGCAAAAAAAGGG + Intergenic
1144738482 17:17568161-17568183 GGGATATGAGTGTAGACAAAAGG - Intronic
1144823239 17:18089986-18090008 GGAATATTACAGCAGCCAGAGGG - Intronic
1145369337 17:22296210-22296232 GTAATTTTAATTTAGACAAATGG - Intergenic
1150573525 17:66409461-66409483 GGTATACTAATGCAGGCAACAGG - Intronic
1151011789 17:70506999-70507021 GGAATATTAATGAGCACAAAGGG + Intergenic
1151074807 17:71258758-71258780 GAAATAATAATGCAGACTCAAGG - Intergenic
1153372122 18:4331092-4331114 GGAATATTACTGGGGAAAAAAGG - Intronic
1155937402 18:31767910-31767932 GGAATATGATTGGACACAAAGGG - Intergenic
1156993000 18:43432743-43432765 GGAATACTAATGAATACTAATGG + Intergenic
1157242646 18:46025462-46025484 GGCATGTAAATGCAGAGAAAAGG - Intronic
1159374473 18:67575265-67575287 GAAATATAAATAAAGACAAATGG + Intergenic
1159408215 18:68034054-68034076 GGAGTAAAAATTCAGACAAATGG + Intergenic
1159477285 18:68938074-68938096 TCAATATTCATGCAGAAAAAAGG + Intronic
1159489245 18:69108588-69108610 TGAATAATAATTCAAACAAATGG + Intergenic
1159654583 18:71017109-71017131 TGAATATTAATAGAGACAAATGG - Intergenic
1164699799 19:30276888-30276910 GGAATATTGTAGCAAACAAAGGG + Intronic
1167812766 19:51848981-51849003 GGAATATTAAAACAAAAAAATGG - Intergenic
1167921005 19:52783324-52783346 GGAAAAGTAATGAAGACGAAGGG - Intronic
1168631317 19:57958759-57958781 GGAATAAAAATGGAGACAAAAGG + Intronic
926447902 2:12967275-12967297 GGAAAATGAATGCAGTGAAATGG - Intergenic
928171547 2:29007651-29007673 GGAATGTCAATACAGGCAAAGGG - Intronic
928527384 2:32155657-32155679 GGCATATTTATACAAACAAATGG - Exonic
928957478 2:36885132-36885154 GGAATATTGTTCCAGTCAAATGG + Intronic
931842237 2:66165614-66165636 GGAGTATCAATGCAGATAAATGG + Intergenic
933446749 2:82390129-82390151 GGCAGATTATTGCAGAGAAAAGG - Intergenic
935172006 2:100617454-100617476 CCTATATTAATGCAAACAAAAGG - Intergenic
935645918 2:105334519-105334541 AGAATATCACTGCAGATAAATGG - Intergenic
935903582 2:107818482-107818504 GGATAATTTATGAAGACAAAAGG - Intergenic
936959362 2:118057223-118057245 AAAATATAAATACAGACAAAGGG - Intergenic
939192709 2:138934756-138934778 GGAATATTAATGGAAATGAAAGG + Intergenic
939626418 2:144482873-144482895 GGAATAATGATATAGACAAATGG - Intronic
940267706 2:151857388-151857410 AGAATATTAATGAAAACAAGTGG + Intronic
940956668 2:159736230-159736252 GGAATCTTCATACACACAAAAGG - Intronic
941080973 2:161060140-161060162 GGATTATTGATGCAAACACATGG + Intergenic
942337954 2:174911119-174911141 GGAATAGTAAACCAGAAAAATGG + Intronic
943122242 2:183750796-183750818 AAAATATGAATGCAAACAAAAGG - Intergenic
943867566 2:192946992-192947014 AAAATATTAATGGAGAAAAAGGG + Intergenic
943914263 2:193608077-193608099 GCAATAATAATGCAGATAGAAGG + Intergenic
944951193 2:204751230-204751252 GAAATCTTAATGGAGGCAAATGG + Intronic
945489253 2:210435579-210435601 AGGAGATTAATGCAGAGAAAAGG + Intronic
945999892 2:216473257-216473279 GGAATATAAATGTGGAGAAAAGG + Intronic
946115811 2:217461116-217461138 GGAAGATAAATGCCCACAAATGG - Intronic
946609127 2:221439174-221439196 GGAATCTTGGTGCAGACCAAAGG + Intronic
947189529 2:227488243-227488265 GGTATATTAATGCACAAAGAAGG - Intronic
947518352 2:230826249-230826271 CAAATATTCATGCAGAAAAATGG - Intergenic
948153228 2:235761560-235761582 GTATCATTAATGCATACAAATGG + Intronic
1168744758 20:229130-229152 GGAATGTTGATGAAGGCAAATGG - Intronic
1169956124 20:11104830-11104852 GGAATATTAAAAGAGAGAAAGGG + Intergenic
1171990946 20:31695900-31695922 GGAAAAATAAAGCAGAGAAAAGG - Intronic
1172565968 20:35930740-35930762 GGAATAGTGCTGCAGACAGAAGG + Intronic
1173342592 20:42165959-42165981 GAAATATTATTTCAGACATATGG - Intronic
1175081875 20:56427451-56427473 GAAAGATTAATGCAGAGAGAAGG - Intronic
1176879813 21:14178287-14178309 GGAATAAAAAGGCAGAAAAATGG - Intronic
1177087830 21:16729492-16729514 GAAAAATGACTGCAGACAAATGG + Intergenic
1178497021 21:33095479-33095501 GAAATGATAAGGCAGACAAATGG + Intergenic
1183041994 22:35187961-35187983 GAAATCTTAATTCAGAGAAAAGG + Intergenic
949554866 3:5144131-5144153 AAAATATTAATTCAGACAATGGG - Intronic
950601850 3:14041997-14042019 AGAATATTGATTCAGACAACAGG - Intronic
951679736 3:25282301-25282323 GGAAGAATACTGCAGACAGAGGG - Intronic
951764424 3:26181648-26181670 GGAAAATTACTGGAGAAAAATGG - Intergenic
951966836 3:28396783-28396805 GGAATAGTAATGAAGATAAACGG - Intronic
951978027 3:28535633-28535655 GGAATAATAAGGCAGAACAAGGG + Intronic
952031073 3:29143443-29143465 GGAATGTAAATGTAGACAACTGG - Intergenic
952191106 3:31024471-31024493 GGTATATTAAAGAAGAAAAATGG - Intergenic
953464686 3:43109316-43109338 GGAATATGACCCCAGACAAAGGG - Intergenic
954765189 3:52909209-52909231 GAAAGATAAATTCAGACAAAAGG + Intronic
955242875 3:57194959-57194981 TGAGCATTAATGGAGACAAAAGG + Intergenic
956001993 3:64739396-64739418 TGAATATTAATTGAGATAAAGGG + Intergenic
956289773 3:67649164-67649186 GGAATAGTTCTGCAGACACAGGG + Intronic
956814330 3:72894334-72894356 GGACTATTGATGGAGAGAAAGGG + Intronic
957683048 3:83463250-83463272 CCAATATTAATTCAGAAAAAGGG - Intergenic
959272314 3:104228396-104228418 TGAATATTAATTCTGACAAAAGG + Intergenic
959404689 3:105946295-105946317 GAAATATTAAGGATGACAAAAGG - Intergenic
959784805 3:110283159-110283181 GGATTTTTAATGAACACAAATGG + Intergenic
960280945 3:115780886-115780908 GGGAGTTTACTGCAGACAAAGGG - Intergenic
963662283 3:148142085-148142107 GTAATAATGATGGAGACAAACGG + Intergenic
965673608 3:171172564-171172586 GGAATTGTATTGCAGAGAAATGG + Intronic
965827506 3:172745634-172745656 GGAATTTTCATGCAGACAGAGGG + Intergenic
965913596 3:173813648-173813670 TGAATAGTAATACAGAGAAAAGG + Intronic
966252181 3:177878331-177878353 GAAATATGAATGCAGACCAAGGG + Intergenic
966765204 3:183455240-183455262 TAAATATTAAAGAAGACAAAAGG + Intergenic
968718570 4:2180677-2180699 GGAATATTAAAGCATTGAAAAGG - Intronic
969520992 4:7677732-7677754 GGGTTATTATTGCAAACAAATGG - Intronic
970405340 4:15757578-15757600 GTAATATTAATGGAAAGAAATGG - Intergenic
971342718 4:25785377-25785399 AGAATTTGAATCCAGACAAATGG + Intronic
971667747 4:29512746-29512768 GGAATATTTATCCGGAGAAAAGG - Intergenic
971803995 4:31330810-31330832 GGACTGTTAATGCATACAAGTGG + Intergenic
972054810 4:34786943-34786965 GAATTATTAATCCAGAAAAAGGG + Intergenic
972332857 4:38079948-38079970 GAAATTCTAATGCACACAAAAGG - Intronic
972343314 4:38171826-38171848 GGAAGATATCTGCAGACAAAGGG + Intergenic
972924054 4:43981939-43981961 GGAAGATTAATAAAGAAAAAAGG - Intergenic
974728464 4:65828290-65828312 GGAAGAATAATGAAGGCAAAGGG - Intergenic
976443450 4:85103642-85103664 GGAATACTCATGTAGAGAAAAGG + Intergenic
977029985 4:91871017-91871039 GGAAGAGTAATGCATACAATTGG - Intergenic
977873787 4:102125307-102125329 AGAATATTAATGGAGAGGAAAGG - Intergenic
978040563 4:104056091-104056113 GGAAAATTAATGTAGAAAATGGG - Intergenic
978543518 4:109844784-109844806 GGAATATATATGCAGAAAAATGG - Intergenic
978959115 4:114654114-114654136 GGAGTATTAATGAAGACCATAGG + Intronic
978969189 4:114781925-114781947 AGAATAATAACTCAGACAAAGGG - Intergenic
979131453 4:117051619-117051641 GAAATATTAAAGTAGAAAAATGG + Intergenic
979426189 4:120570821-120570843 TGAATATTAAGGCAGACATTGGG + Intergenic
980040903 4:127938749-127938771 GTTATATTAATTCAGCCAAATGG + Intronic
980611265 4:135167111-135167133 GGAAAATTACTTCAGACCAAGGG - Intergenic
980955332 4:139422464-139422486 GGAATATTTTTTCAGACAAAAGG - Intergenic
981066889 4:140495188-140495210 GGAAGAGTATTTCAGACAAAGGG - Intronic
983068972 4:163246891-163246913 GGAATAACAATGAAGACAAGGGG + Intergenic
983253961 4:165378190-165378212 GGAATATAAATCCCGACTAAGGG + Intronic
983506343 4:168557610-168557632 GGAAGATTACTGCAGTCCAATGG - Intronic
983959319 4:173733090-173733112 GGAAAAATATTCCAGACAAAAGG - Intergenic
984187735 4:176566745-176566767 GAAATATAAATACAGTCAAATGG - Intergenic
984272436 4:177564057-177564079 GGAATCTTTATACAGAAAAAAGG - Intergenic
984358715 4:178699626-178699648 GGAATATCAGTGTAGACAACAGG - Intergenic
985432080 4:189890735-189890757 GGAATGCCAATACAGACAAATGG - Intergenic
985922477 5:2989382-2989404 GAAATATTAATTCATACAAATGG + Intergenic
986563135 5:9084017-9084039 GGAATATCATTGCTAACAAAAGG + Intronic
986573006 5:9184332-9184354 GCAATATTAATTCAGAATAAAGG - Intronic
986889617 5:12285638-12285660 GGAAGATTAGGGCAGAGAAAAGG - Intergenic
987542409 5:19272693-19272715 ACAATATAACTGCAGACAAATGG - Intergenic
988198391 5:28037900-28037922 GGAATAATAAGGCAGCCAAAGGG + Intergenic
988200249 5:28059078-28059100 GGAATATTAGTACAGAGAGAAGG + Intergenic
988419081 5:30983951-30983973 AGAATATTATTTCAGTCAAAGGG - Intergenic
990301903 5:54457797-54457819 AGAATGATAATCCAGACAAATGG - Intergenic
990799984 5:59590066-59590088 TGAATATTTTTGCAGACATAAGG + Intronic
990829845 5:59943904-59943926 GGACTATTATGGCAGACGAAGGG + Intronic
990832557 5:59975933-59975955 CAAATATGACTGCAGACAAATGG - Intronic
994319701 5:98379064-98379086 TGAATATTAAAGTAGATAAAAGG + Intergenic
995808439 5:116079757-116079779 GGAGTAGGAATGCAGGCAAAAGG - Intergenic
995888807 5:116926304-116926326 TGCATATTAAAGAAGACAAACGG - Intergenic
996456301 5:123686875-123686897 AGAATATCAATGCAGAGAAGAGG + Intergenic
996875819 5:128239287-128239309 GAAATATTCATGGAAACAAAAGG - Intergenic
997148634 5:131466820-131466842 AGAAGATTATTGCAAACAAATGG + Intronic
997235002 5:132267612-132267634 GGAATGGTAAGGCAGGCAAAGGG + Intronic
997901669 5:137771984-137772006 GGAACATTAATTTAGACAAAGGG - Intergenic
998330126 5:141318107-141318129 GAAATATTAATCCAAACCAATGG + Intergenic
1000827941 5:166069798-166069820 ACAATCATAATGCAGACAAAAGG + Intergenic
1000870216 5:166567504-166567526 AGAATATTACAGAAGACAAATGG + Intergenic
1003491469 6:6626179-6626201 AGAAGATTAATGGAAACAAAAGG + Intronic
1003778068 6:9391475-9391497 CTAAAATTTATGCAGACAAAGGG - Intergenic
1004341436 6:14811364-14811386 AGAAAATAAATGCAGACCAAAGG - Intergenic
1005022821 6:21433945-21433967 GGAAAATTAATGCAGACACTGGG + Intergenic
1005127543 6:22465291-22465313 GGAATATGAAGACAGAAAAAGGG - Intergenic
1005455648 6:26017431-26017453 GGAACGTTGGTGCAGACAAAGGG - Exonic
1009809426 6:68640841-68640863 AGAAAATGAATGCAGACTAATGG + Intronic
1010742640 6:79526596-79526618 AAAATATTAATTCAGACAATGGG + Intronic
1011860906 6:91754807-91754829 GGAATAATAATGCAGATTGATGG + Intergenic
1012003134 6:93679809-93679831 TAAATAGTAATGCAGAGAAAAGG + Intergenic
1012093480 6:94930020-94930042 GGAAAATTTATGAAGCCAAATGG - Intergenic
1012213984 6:96558959-96558981 AGCATATTAAGGCAGAGAAAAGG + Intergenic
1012246496 6:96932133-96932155 TGAATCTTTATGCAGCCAAAGGG - Intronic
1012339240 6:98098725-98098747 AGAATATTTATGAAGACAACTGG + Intergenic
1012743570 6:103053875-103053897 GGAATATTTATGCAAATTAATGG - Intergenic
1013363603 6:109417888-109417910 GGAAGGTAAAGGCAGACAAAGGG - Intronic
1015091704 6:129366069-129366091 AGAATATTAATGCTATCAAATGG - Intronic
1016023847 6:139264347-139264369 GGAATATTTATAAATACAAACGG - Intronic
1016130394 6:140461307-140461329 GGAATATTATTTCATGCAAAAGG + Intergenic
1017063766 6:150509690-150509712 ACAATTTTAATGCAGACAAAGGG - Intergenic
1018883274 6:167906573-167906595 GGAATTTGTAGGCAGACAAAAGG - Intronic
1021912150 7:25396981-25397003 GGAATATTTATGCACAAAGATGG - Intergenic
1022318702 7:29267562-29267584 GGCTTATTAAAGCATACAAAAGG + Intronic
1023213269 7:37831477-37831499 GGTCTATTTATGCAAACAAAGGG - Intronic
1024032639 7:45476776-45476798 GGAAAATTAATGAAAACAAAAGG + Intergenic
1025595229 7:62915078-62915100 GGGAGCTTAATGAAGACAAAGGG + Intergenic
1027218322 7:76198355-76198377 GAAATATTCATGCAGCCAGAAGG + Intergenic
1027443833 7:78248844-78248866 GCAATAAAAAAGCAGACAAATGG + Intronic
1027526221 7:79272052-79272074 GGAATAATAATTCATAAAAATGG - Intronic
1028218956 7:88171886-88171908 CTAATATTAATGTAAACAAATGG - Intronic
1028940619 7:96518591-96518613 TGAATATAAATTCAGAGAAAAGG - Intronic
1030797848 7:113811609-113811631 TGATAATTAATGCATACAAAGGG - Intergenic
1031856785 7:126932592-126932614 GGCATATTATTGCATTCAAAGGG + Intronic
1032609855 7:133401129-133401151 GGAATAATACTGTATACAAATGG - Intronic
1033894518 7:146054462-146054484 AAAATATTGATTCAGACAAAGGG - Intergenic
1036168438 8:6459520-6459542 TGAATATTAATGTTGAAAAAGGG + Intronic
1036983321 8:13496286-13496308 ATAATAATAATGCAGATAAAAGG + Intronic
1038091471 8:24258276-24258298 TTAATATGAATGCAGAAAAATGG - Intergenic
1038860504 8:31383160-31383182 GGAATAATAATGAAGGTAAATGG + Intergenic
1040288368 8:46111866-46111888 GGGATGTTGAGGCAGACAAAGGG - Intergenic
1040289947 8:46119170-46119192 GGAATATTGAGGCAGGCAGAGGG - Intergenic
1040305082 8:46207895-46207917 GGGACATTAAGGCAGGCAAAGGG + Intergenic
1040319399 8:46285102-46285124 GGAACATTAAGGCAGGCAGAAGG - Intergenic
1040320285 8:46290941-46290963 GGGATATTGAGGCAGGCAAAAGG - Intergenic
1040341246 8:46442271-46442293 GGAACATTGAGGCAGGCAAAGGG - Intergenic
1040983599 8:53269880-53269902 AGAATATTGATTCAGACAATGGG - Intergenic
1042064533 8:64859238-64859260 GGAAGAGCACTGCAGACAAAAGG - Intergenic
1043541732 8:81270722-81270744 GGAAAGTGAATGCAGACCAAAGG - Intergenic
1044844625 8:96367967-96367989 GGAGTATTTATCCAGAGAAATGG + Intergenic
1044924657 8:97199997-97200019 TGAATATTAAAGGATACAAAAGG - Intergenic
1044955326 8:97474253-97474275 GCAATATAAAAGCAGAGAAATGG - Intergenic
1045405600 8:101863740-101863762 GGAGGACTAATTCAGACAAAGGG + Intronic
1046102507 8:109631027-109631049 GGAAAATGAAGGCAGACAAGGGG + Intronic
1046163391 8:110396506-110396528 GTAAGATTACTTCAGACAAAGGG + Intergenic
1046180629 8:110642351-110642373 GGAATATTAATGCATATCAGAGG - Intergenic
1047673187 8:127171351-127171373 GGAAAATTAAAGCAGAAAAATGG - Intergenic
1048152475 8:131907736-131907758 AGAATATGAATGAACACAAAAGG - Intronic
1048493369 8:134914800-134914822 GGAAATGTAATGCAGGCAAAGGG - Intergenic
1048741826 8:137569191-137569213 AGATTATTCATGTAGACAAAAGG - Intergenic
1048837119 8:138530462-138530484 GGAATCTTAAGTGAGACAAAAGG - Intergenic
1049881515 8:145067480-145067502 GGAAGAATAATCCAGGCAAAAGG - Intergenic
1050683498 9:8141072-8141094 GGAATATTCAGGCAAACACATGG + Intergenic
1050989266 9:12127067-12127089 GGAATATAAATACAGTAAAAAGG + Intergenic
1051362229 9:16291459-16291481 AGAAAAATAATGCAGGCAAAGGG + Intergenic
1051463393 9:17349367-17349389 GAAACATTATTGCAGAAAAAGGG - Intronic
1052727020 9:32241184-32241206 GGAAGATTAAAGGAGACAAAAGG - Intergenic
1055200709 9:73656900-73656922 GGAATATTAATTTAGAATAATGG - Intergenic
1058729568 9:107836897-107836919 GGAAGAATAATGCTGCCAAAAGG - Intergenic
1059380804 9:113922194-113922216 GGACAATTTATGCAGATAAAAGG + Intronic
1060268187 9:122124434-122124456 GGCATATCAGTGCTGACAAAGGG - Intergenic
1060545910 9:124458815-124458837 GGCCTAATAATGCACACAAAAGG + Intronic
1060659758 9:125397912-125397934 GGAAAATTACTGGAAACAAAAGG - Intergenic
1186450361 X:9667648-9667670 GTAATATTAAGGGATACAAAAGG + Intronic
1186825658 X:13337519-13337541 TGAATTTTAATTCAGCCAAATGG + Intergenic
1187147416 X:16650234-16650256 AGAGTATTAATGCAAACAGAAGG - Intronic
1187398773 X:18940931-18940953 GGAATATGATTGGAGACATAGGG + Intronic
1187544948 X:20241057-20241079 GGAATAGTAAAGCAGGCATAAGG - Intronic
1192894743 X:75430238-75430260 AGATTATTAATACAGAGAAAAGG + Intronic
1194270052 X:91801351-91801373 TGAGTCATAATGCAGACAAAAGG + Intronic
1197153006 X:123240417-123240439 GGATTTTTAATGCAGCAAAAAGG + Intronic
1197415574 X:126167658-126167680 GGAATATTGAGGCAGAGAAGGGG - Intergenic
1198754900 X:139972390-139972412 GGAATATACATGGAAACAAATGG + Intergenic
1200587293 Y:5022790-5022812 TGAGTCATAATGCAGACAAAAGG + Intronic
1200745635 Y:6901641-6901663 GGAATATATATGCATATAAAAGG + Intergenic