ID: 1107730933

View in Genome Browser
Species Human (GRCh38)
Location 13:43348074-43348096
Sequence CAGCATGAGCAGATGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 870
Summary {0: 1, 1: 0, 2: 20, 3: 95, 4: 754}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107730933_1107730936 -8 Left 1107730933 13:43348074-43348096 CCTCCCTGCATCTGCTCATGCTG 0: 1
1: 0
2: 20
3: 95
4: 754
Right 1107730936 13:43348089-43348111 TCATGCTGTGCACTTATCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 121
1107730933_1107730937 -7 Left 1107730933 13:43348074-43348096 CCTCCCTGCATCTGCTCATGCTG 0: 1
1: 0
2: 20
3: 95
4: 754
Right 1107730937 13:43348090-43348112 CATGCTGTGCACTTATCCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 90
1107730933_1107730939 9 Left 1107730933 13:43348074-43348096 CCTCCCTGCATCTGCTCATGCTG 0: 1
1: 0
2: 20
3: 95
4: 754
Right 1107730939 13:43348106-43348128 CCTTGGGTCTCTCCCACTCCTGG 0: 1
1: 0
2: 2
3: 47
4: 314
1107730933_1107730940 18 Left 1107730933 13:43348074-43348096 CCTCCCTGCATCTGCTCATGCTG 0: 1
1: 0
2: 20
3: 95
4: 754
Right 1107730940 13:43348115-43348137 TCTCCCACTCCTGGTCCCCCTGG 0: 1
1: 0
2: 1
3: 45
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107730933 Original CRISPR CAGCATGAGCAGATGCAGGG AGG (reversed) Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
900546669 1:3233269-3233291 CAGCATTTTCAGAAGCAGGGTGG + Intronic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901322525 1:8348498-8348520 CACTCTGAGCAGGTGCAGGGAGG - Intergenic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902603457 1:17555768-17555790 AAGCAAGAACAGATGCAGGTGGG - Intronic
903135712 1:21308111-21308133 CAGCATGAGCAGAGGTCTGGAGG - Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903300268 1:22373885-22373907 GAGCATGAGCAAATGCTTGGAGG - Intergenic
903340226 1:22649287-22649309 CTGCATGGGCAAAGGCAGGGAGG - Intergenic
903537632 1:24077450-24077472 CAGCAAGGGCAAAGGCAGGGAGG - Intronic
904460634 1:30677661-30677683 CAGCATGTGCAAAGGCTGGGAGG + Intergenic
904614785 1:31743852-31743874 AAGAATCAGCAAATGCAGGGAGG + Intronic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
905996878 1:42388907-42388929 CACCAAGAGCAGAAGTAGGGAGG + Intronic
906008671 1:42502442-42502464 GAGCACGAGCCGAAGCAGGGCGG - Intronic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906513228 1:46423426-46423448 CCGCATAAGCAGACGCATGGAGG - Intergenic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906614630 1:47225787-47225809 CAGCAGGACCAGGTGCGGGGGGG + Exonic
906689808 1:47785063-47785085 CAGCAGGATCAAATGCACGGAGG + Intronic
906714434 1:47956382-47956404 GAGCATGAGCTGAAGCAGGGCGG + Intronic
906718192 1:47985937-47985959 CAACATGAGCAAATGCATGGAGG + Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907048315 1:51313440-51313462 CACCATGATCAGATGAGGGGAGG - Intronic
907310262 1:53535016-53535038 AAGCATGAACAAAAGCAGGGAGG + Intronic
907386297 1:54127725-54127747 CAGCATGTGCAAATGCAAAGAGG - Intergenic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
908180693 1:61602254-61602276 CATCATGAGCAAAGGCACGGAGG + Intergenic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911814759 1:102333144-102333166 CAGGATAGGAAGATGCAGGGTGG - Intergenic
911895198 1:103424840-103424862 CAGCATGAGCAGGCAAAGGGAGG - Intergenic
912866734 1:113264344-113264366 GCTCATGAGAAGATGCAGGGAGG - Intergenic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913474331 1:119222649-119222671 AAGCAGCAGCAGATTCAGGGTGG + Intergenic
913978108 1:143481591-143481613 AGGCTTGAGTAGATGCAGGGTGG - Intergenic
914072512 1:144307220-144307242 AGGCTTGAGTAGATGCAGGGTGG - Intergenic
914106642 1:144659136-144659158 AGGCTTGAGTAGATGCAGGGTGG + Intergenic
914683506 1:149958000-149958022 GAGCGTGAGCCGAAGCAGGGCGG - Intronic
914926537 1:151893613-151893635 CATCAGGCACAGATGCAGGGGGG + Intronic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917474607 1:175358079-175358101 TAGCATGTGCAAATGCATGGAGG + Intronic
917509953 1:175661761-175661783 GAGGATGAGCAGATGTAGAGGGG - Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919153227 1:193726875-193726897 CAACATGAGCAGAAGGAGTGTGG + Intergenic
919782629 1:201230703-201230725 CACCATGAGCAAAGGCAAGGAGG + Intergenic
919787425 1:201268705-201268727 CAGCAGCAGCTGCTGCAGGGAGG + Intergenic
920185860 1:204159037-204159059 GAGCAAGAGGAGATGCAAGGTGG - Intronic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921882467 1:220270983-220271005 TAGCATGTGCAGAGGAAGGGAGG - Intronic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922239620 1:223747190-223747212 CAGCAAGAGCAGATGGGGTGAGG - Intronic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923017366 1:230137181-230137203 GAGCCTGAGTGGATGCAGGGAGG + Intronic
923194501 1:231652061-231652083 CAGGGTGAGCCGAAGCAGGGCGG - Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924130419 1:240901258-240901280 GACCATGAGCTGAAGCAGGGTGG - Intronic
924359587 1:243223549-243223571 CACCATAAGCAGTTGGAGGGCGG - Intronic
924508999 1:244712766-244712788 CATCAGGCGCAGATGCAGAGAGG - Intergenic
1064247172 10:13678230-13678252 CAGCATTAGCGGATACAGAGAGG - Intronic
1064738038 10:18403179-18403201 CATAAATAGCAGATGCAGGGAGG + Intronic
1066419017 10:35247109-35247131 CAGCAGGGGCAGAGGCATGGAGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067018079 10:42772315-42772337 CATGATGACCAGCTGCAGGGAGG + Intergenic
1067146976 10:43701200-43701222 GGGCAGGACCAGATGCAGGGGGG + Intergenic
1067665711 10:48276498-48276520 CAGGTTCAGCAGATTCAGGGTGG - Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1068833127 10:61520715-61520737 CAGCACAAGCACATGCATGGAGG - Intergenic
1068892774 10:62165048-62165070 CAGCATGAGCAAAGGCCTGGGGG - Intergenic
1069032924 10:63617123-63617145 CAGCATGCACAGAGGCAGTGAGG - Intronic
1069740323 10:70683141-70683163 CTACGTGAGCACATGCAGGGGGG - Intronic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1070158179 10:73849222-73849244 CTTCATGAGCAGAGGCACGGAGG + Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1071207131 10:83294432-83294454 AAGCGTGAGCCGAAGCAGGGCGG + Intergenic
1071277205 10:84066119-84066141 GGGCATAAGCAGGTGCAGGGAGG - Intergenic
1071695223 10:87863280-87863302 CAGCAAGTGCAGCTGCAGGCTGG + Exonic
1071709894 10:88039715-88039737 CAACTTGAGCAAATGCAGGAGGG + Intergenic
1072287247 10:93927842-93927864 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072728885 10:97831521-97831543 CATTAGGAGCAGATGGAGGGAGG + Intergenic
1073331198 10:102670919-102670941 CACCAGGAGCAGGGGCAGGGAGG - Intergenic
1073667005 10:105544965-105544987 CTGCAGGAGATGATGCAGGGAGG - Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074704476 10:116118859-116118881 GAGCTTGGGCAGATGCAGGGAGG + Intronic
1074809728 10:117091690-117091712 CAGCATGAGCAAATGCATACTGG - Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1075566229 10:123506440-123506462 CTGCATGGGAAGATGCAGGAAGG - Intergenic
1075745227 10:124722927-124722949 CAGCATGAGCAGAGGTCTGGAGG - Intronic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077171590 11:1168726-1168748 CTGCATGAACAGCTGCATGGTGG - Exonic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077321026 11:1942050-1942072 CACCAGGAGCAGGTGCTGGGAGG + Intergenic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077414599 11:2418891-2418913 CAGCATGAGCGCGTGCAGTGTGG - Intronic
1077790071 11:5429617-5429639 AAACATGGGCAGATGCAGAGGGG + Intronic
1077916728 11:6616460-6616482 CAGCATGAGCCACTGCAGGAAGG + Exonic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078793546 11:14569386-14569408 GAGCATGAGGTGAAGCAGGGTGG + Intronic
1078809509 11:14743856-14743878 GAGGGCGAGCAGATGCAGGGTGG - Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080031417 11:27665443-27665465 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080891020 11:36409367-36409389 CAACAAGAACAGAAGCAGGGTGG - Intronic
1081103052 11:39028961-39028983 GAGCTTGAGCTGGTGCAGGGGGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081632526 11:44699579-44699601 CTGCATGAGCAAAGGCATGGAGG + Intergenic
1082287167 11:50330069-50330091 AAGCGTGAGCCGAAGCAGGGTGG - Intergenic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083254831 11:61489666-61489688 CAGCATGAGCAAAGGTGGGGAGG + Intronic
1083776902 11:64898446-64898468 CAGCGTGTTCAGAGGCAGGGTGG - Intronic
1084321403 11:68375438-68375460 CAGCACGAGCAGGGGCAGGGAGG - Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085395345 11:76204421-76204443 CAGCACGAGCAGAAGCCTGGAGG - Intronic
1085717148 11:78882358-78882380 CAGCATGGGCAAAAGCATGGTGG - Intronic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086417660 11:86605314-86605336 CAGCATGTGCAGATGCCCTGAGG - Intronic
1086470950 11:87109514-87109536 CAGCATGAGGAGATGAAGTGAGG + Intronic
1088034697 11:105296972-105296994 GAGCAGGAGTAGAAGCAGGGTGG - Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1089758183 11:120702390-120702412 CAACCTGTGGAGATGCAGGGTGG + Intronic
1089784990 11:120901342-120901364 CAGCATGTGCCAAGGCAGGGAGG - Intronic
1090491923 11:127171548-127171570 CAACATGAACAGATGAAGTGAGG - Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1091041446 11:132284979-132285001 AAGCATGAGCAGGAGCAGGAAGG + Intronic
1091096409 11:132826460-132826482 CAGCAAGAGAAGATGCAAAGGGG + Intronic
1091794139 12:3287738-3287760 AAGAATGAGCAGAGACAGGGTGG - Intergenic
1091960596 12:4690929-4690951 CAGCATGAGCAATTGCAGTGGGG + Exonic
1092065622 12:5587817-5587839 CAGCCTGAGGAGGTGCATGGGGG - Intronic
1092269749 12:7014035-7014057 TAGCATGAGCAGAGGCACTGAGG - Intronic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1094669065 12:32551151-32551173 CAGCATGAGCAAGTGCTGGGTGG + Intronic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095383684 12:41625675-41625697 CAGCATGAGAAAATGTTGGGCGG + Intergenic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096044944 12:48554166-48554188 GAGCATGAGCCAAAGCAGGGTGG - Intergenic
1096678947 12:53242148-53242170 GGGCAAGAGCAGGTGCAGGGTGG - Intergenic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1098281574 12:68867774-68867796 CAGCATGAGCAGTGGCAGCCTGG - Intronic
1098638553 12:72813533-72813555 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1099022610 12:77424846-77424868 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099806853 12:87531128-87531150 GAGCATGAGCCAAAGCAGGGTGG + Intergenic
1099965483 12:89440795-89440817 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1101336614 12:103802366-103802388 CAGCAGGAGCAAATGCCAGGTGG + Intronic
1102496086 12:113320524-113320546 CAGCAGGAGAGGGTGCAGGGTGG - Intronic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103203662 12:119110790-119110812 GAGCATGAGCCAAAGCAGGGCGG - Intronic
1104736530 12:131138851-131138873 CAGCGTGGACAGATGCATGGGGG + Intronic
1104756114 12:131270331-131270353 CAGCATCATCAGATGAAGGCAGG + Intergenic
1104777662 12:131400694-131400716 CAGCATCATCAGATGAAGGCAGG - Intergenic
1105602976 13:21903379-21903401 CAGTATGTGCAGAGGCCGGGGGG - Intergenic
1106355291 13:28976284-28976306 CAGCATGAGTTGAGGCAGAGAGG + Intronic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1107305606 13:39015007-39015029 CAGTATGAGCAAATGTATGGGGG - Intronic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108240295 13:48457302-48457324 CAGGACGAGCAGCTGCAGAGAGG - Intronic
1108850197 13:54718706-54718728 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1110019873 13:70457150-70457172 GAGGGCGAGCAGATGCAGGGTGG + Intergenic
1110630146 13:77698077-77698099 CAGCAGCAGCAGGTGCGGGGCGG - Intronic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110895697 13:80749586-80749608 CAGCATGAGCAGAACTAGAGTGG + Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1112080118 13:95959813-95959835 CAGTGTTAGCAGGTGCAGGGAGG - Intronic
1112641230 13:101277873-101277895 CCACATGAGCAGAGGCAGAGAGG - Intronic
1113383079 13:109821272-109821294 CAGGAAGAGCAGATGCAGGGAGG - Intergenic
1114484176 14:23053358-23053380 CAGCAAGCCCAGCTGCAGGGAGG + Intronic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115123174 14:29961335-29961357 GAGCGTGAGCTGAAGCAGGGTGG - Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115480013 14:33851433-33851455 GAGGATGAGCAGAGGTAGGGGGG + Intergenic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117442899 14:55776869-55776891 CAGTAAGAGAAGATGCAGGCCGG + Intergenic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117973376 14:61274220-61274242 CAGCATGAGCAAAGACACGGAGG + Intronic
1118317871 14:64736820-64736842 AAGCATGAGCAGAGTCAGCGCGG - Intronic
1119009727 14:70972234-70972256 GAGGAGGAGCAGATTCAGGGTGG + Intronic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120478962 14:85024318-85024340 CAGTGTGAGCCGAAGCAGGGCGG - Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1121233002 14:92372154-92372176 CAGCCTGCTCAAATGCAGGGAGG + Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121602219 14:95213766-95213788 CAGGATGAGCAGAAGCAATGGGG - Intronic
1121678520 14:95773784-95773806 CAGCAAGAGCAAACGCAGGGAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1122821175 14:104345958-104345980 CAGCAGGGGCACATGCAGTGGGG - Intergenic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1202891564 14_KI270722v1_random:163983-164005 AACCATGTGCATATGCAGGGAGG - Intergenic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1124623841 15:31297068-31297090 CAGAAAGTGCAGAGGCAGGGTGG + Intergenic
1124892319 15:33744699-33744721 CAGCAGGTGCAGACCCAGGGAGG + Intronic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1126097539 15:45100169-45100191 CTGCAAGAGAAGATGCAGCGAGG - Exonic
1126793645 15:52242873-52242895 CAGCATGAGTAAAGGCATGGAGG + Intronic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128354918 15:66919354-66919376 CAGCCTGAGCAGGGGCAAGGAGG + Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129301825 15:74629897-74629919 CCGCATGAGGAGATGGAGGGCGG + Exonic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129355221 15:74986356-74986378 CCGCATGAGCAAAAGCAAGGAGG + Intronic
1129377533 15:75143553-75143575 CAGAATGAGCAGATCCAGCCAGG + Intergenic
1130919967 15:88335606-88335628 CAGCATGAACAGAGGCTTGGAGG + Intergenic
1131071652 15:89470070-89470092 CAGCGTGAGAGGGTGCAGGGTGG - Intergenic
1131077997 15:89510345-89510367 CAGCATGTGCAAAGGCATGGAGG + Intergenic
1131225844 15:90623888-90623910 CAGCATGCGCAAAAGCAGGGAGG - Intronic
1131423081 15:92323616-92323638 CAGAATGGGGAGATCCAGGGTGG - Intergenic
1132226243 15:100143970-100143992 CAGAATGACCAGGTGCTGGGTGG - Intronic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1132463914 16:68882-68904 AAGCAGGAGCCGATGCAGGGAGG + Intronic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1133018732 16:2956579-2956601 CAGCGTGGGCAGAGCCAGGGAGG - Intergenic
1133050752 16:3115959-3115981 CAGAACCAGCAGATGCAGGAAGG - Intronic
1136003219 16:27311949-27311971 CAGCATGAGCAAATACCTGGAGG - Intergenic
1136686704 16:31999156-31999178 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1136787316 16:32942693-32942715 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1136882460 16:33911089-33911111 CAGCATGTGCAGAAACAGGGTGG - Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1137525079 16:49228245-49228267 GAGCATGAGCCGAAGCAGGGTGG + Intergenic
1137558275 16:49486816-49486838 CACCATGAGCAAAGGCATGGAGG + Intergenic
1137693964 16:50448860-50448882 CAGGATTAGCAGATCAAGGGAGG - Intergenic
1137828040 16:51516775-51516797 GAGAGAGAGCAGATGCAGGGTGG + Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138190669 16:55011061-55011083 CAGCTGGAGCAGCTGCAGGATGG + Intergenic
1138702545 16:58879089-58879111 GAGCGTGAGCCGAAGCAGGGTGG - Intergenic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1139657248 16:68396450-68396472 CAGCATGTGCAAAGGCATGGAGG - Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1139872784 16:70120829-70120851 TAGCATGAGAAGAAGCAAGGTGG + Intronic
1140253158 16:73312573-73312595 ATGCATGAGCAAATGCAGAGGGG + Intergenic
1140362992 16:74360501-74360523 TAGCATGAGAAGAAGCAAGGTGG - Intergenic
1141173994 16:81707566-81707588 GAGCAGGAGTAGAAGCAGGGAGG + Intronic
1141253795 16:82382490-82382512 GAGATTGAGCAGGTGCAGGGTGG + Intergenic
1142406108 16:89891159-89891181 CAGCCTGGGCAGATGCCAGGAGG - Intronic
1203089550 16_KI270728v1_random:1204365-1204387 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG + Intronic
1143100607 17:4502748-4502770 CAGCTTGAGCAGAGGCATGAAGG - Intronic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143490808 17:7284290-7284312 CAGCAGGACCAGCTGCAGGAGGG - Exonic
1143554710 17:7652759-7652781 CACCCTGGGCAGAGGCAGGGAGG - Intronic
1143631514 17:8142885-8142907 CAGTAAGAGCAGTTGAAGGGAGG - Intronic
1143977411 17:10840141-10840163 GAGCAGGAGCAGCTACAGGGTGG - Intergenic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1144859576 17:18292416-18292438 CAGCAGGAGCTGATGGAGAGTGG + Intronic
1146507329 17:33416671-33416693 CAGCATGTGCAGATGAATGAGGG - Intronic
1147147667 17:38494819-38494841 CAGCACGTGCAGAAACAGGGTGG + Intronic
1147872355 17:43596533-43596555 CAGCATGAGCAAAGGCTTGGAGG - Intergenic
1147988965 17:44321885-44321907 CTGCATGTGTAGAGGCAGGGAGG - Intronic
1149006562 17:51812136-51812158 CAGCATGAGCTGGTACAGGTGGG - Intronic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1149500213 17:57146759-57146781 CAGGATGGGCAGAGACAGGGAGG - Intergenic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1150228241 17:63535290-63535312 CAGCATGAGCAGCGGCACTGAGG - Intronic
1151561274 17:74871128-74871150 CAGCGTGAGCCGAGGCAGGTGGG - Intronic
1151758540 17:76088175-76088197 CACCATGAGCAGGTGCACTGGGG - Intronic
1152301193 17:79495922-79495944 CAGCCTGAGCAGTGGCAGCGTGG + Intronic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152696968 17:81802461-81802483 TAGCAGGAGCAGATGCTGGCAGG + Intergenic
1152929110 17:83100936-83100958 CAGCTTGAGCAGGGGCAGGCTGG + Intergenic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153350644 18:4077584-4077606 CAGCAAGAGAGGAAGCAGGGTGG - Intronic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1156699301 18:39806181-39806203 CAACATGAGCAACTGGAGGGAGG - Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157285408 18:46374038-46374060 CAGCATGAGCAGGGCCAGGCTGG + Intronic
1157722510 18:49936320-49936342 CTCCATGAGCAGATGCAGGGAGG + Exonic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158367032 18:56747724-56747746 CAGCCTGTGCAGATGCAGGTGGG + Intronic
1159942476 18:74418895-74418917 CAGCATGTGAAGAGGCAAGGAGG + Intergenic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1161347610 19:3776086-3776108 CCTCATGAGCAGCTGCTGGGAGG - Intergenic
1161348210 19:3778320-3778342 CCTCATGAGCAGCTGCTGGGAGG - Exonic
1161457455 19:4376690-4376712 CAGCATGGGAAGATCCAGGGAGG - Intronic
1161501337 19:4617731-4617753 CAGCATGGGCAAAGGCCGGGTGG - Intergenic
1161669498 19:5597634-5597656 CAGCTTGAGGAGATGCAGCACGG - Intronic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1162306888 19:9880242-9880264 CAGCATGGGCAAAGGCAGGGAGG + Intronic
1162718314 19:12647548-12647570 CAGCGTGAGCAGGTGCACCGAGG + Exonic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1164597178 19:29537906-29537928 CAGCATGGGCAGCTGTGGGGAGG - Intronic
1165050745 19:33139949-33139971 CAGCATGGGCAGACCCAGGGAGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG + Intergenic
1166702933 19:44892510-44892532 CCGAGTGTGCAGATGCAGGGAGG - Intronic
1166709932 19:44930350-44930372 CAGCCTGGGCATACGCAGGGAGG + Intergenic
1167213406 19:48148168-48148190 AAGCATGTTCAGAAGCAGGGAGG + Intronic
1167681099 19:50921939-50921961 CAGCATCAGCAGGTGCTGAGTGG + Intergenic
1168281616 19:55308860-55308882 CAGCATGAGCAGGTGCTCTGGGG + Intronic
1168306112 19:55437158-55437180 CAGCCTGAACATCTGCAGGGTGG + Intronic
1168321280 19:55511469-55511491 CAGCGTGGGCAGAGGCTGGGAGG + Intronic
925084477 2:1097229-1097251 GTGCAGGTGCAGATGCAGGGAGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925198590 2:1947894-1947916 CAGCCTGAGCGTATCCAGGGTGG + Intronic
925675909 2:6360749-6360771 CAGCAGAAGCAGATGCCTGGAGG + Intergenic
925933152 2:8727184-8727206 CAGCATGAGCAGACTCAGGTGGG - Intronic
926348709 2:11975369-11975391 CAGCATTGGCAGCTGCAGGTGGG + Intergenic
926417043 2:12659847-12659869 CAGAATGAGCAGAAACAGGTTGG - Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927112661 2:19875101-19875123 CAGCCTGAGCAGATGCTGTAAGG + Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
928325533 2:30316626-30316648 CACCATGAGCAGAAGTAGGCAGG - Intronic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929438352 2:41946219-41946241 CAACATGAGCAGGGGCACGGAGG + Intronic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930243450 2:48959426-48959448 CTGCAAGAGCAAATGGAGGGAGG - Intergenic
930688429 2:54333404-54333426 CAGCATGTGCAGGTGCCGTGAGG + Intronic
930893666 2:56421207-56421229 GAGCACGAGCTGAAGCAGGGTGG + Intergenic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931107204 2:59069362-59069384 CAGCATGAGCAGATGTTTGAGGG - Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933269321 2:80216226-80216248 CAGTGTGAGCCGAAGCAGGGCGG - Intronic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933718179 2:85377386-85377408 CAGGTAGAGCAGATGCAGGAGGG - Exonic
933971955 2:87477018-87477040 CAGCATGTGCAAAGGCATGGAGG + Intergenic
934173671 2:89560473-89560495 CAGCCTGAGAAGATGCTTGGCGG + Intergenic
934283985 2:91634822-91634844 CAGCCTGAGAAGATGCTTGGCGG + Intergenic
934293105 2:91716788-91716810 AGGCTTGAGTAGATGCAGGGTGG - Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935091802 2:99901736-99901758 GAGAAAGAGCAGATGCAGGGAGG - Intronic
935618391 2:105108593-105108615 GGGCATGAGGAGACGCAGGGTGG - Intergenic
935738252 2:106123938-106123960 GGGCCTGAGCAGGTGCAGGGAGG + Intronic
935982724 2:108643343-108643365 GAGGATGAGCCGAAGCAGGGTGG + Intronic
936125241 2:109783703-109783725 CAGGAAGGCCAGATGCAGGGTGG + Intergenic
936219452 2:110587765-110587787 CAGGAAGGCCAGATGCAGGGTGG - Intergenic
936321771 2:111473179-111473201 CAGCATGTGCAAAGGCATGGAGG - Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938163625 2:129008190-129008212 CAGCAGGAGCAGGAGCATGGTGG - Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941638273 2:167960078-167960100 CAACAGCAGCAGATGCAGGAAGG + Intronic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942803378 2:179901853-179901875 GAGCAGGAGCAAGTGCAGGGTGG + Intergenic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
943300059 2:186186869-186186891 GAGCGTGAGCGGAAGCAGGGAGG - Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
946591520 2:221254504-221254526 GAGTATGTGCAGATGCAGGGAGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947301102 2:228689293-228689315 AGGCAGGAGCAGATGAAGGGAGG - Intergenic
947844055 2:233229944-233229966 CAGCATGACCTGGGGCAGGGGGG - Intronic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948313918 2:237012325-237012347 CTGCATGAGAAGAGGAAGGGAGG + Intergenic
948565776 2:238885109-238885131 CAGATTGTGCAGATGCAGGGAGG + Intronic
948865189 2:240771565-240771587 CAGGGTGGGAAGATGCAGGGAGG - Intronic
1168876378 20:1174851-1174873 CAGCATGAGCAGAGGCTCAGAGG - Intronic
1169393066 20:5205882-5205904 CAGCAAAGGCAGAGGCAGGGCGG + Intergenic
1170331710 20:15219365-15219387 CAGCAGGAGTAGGAGCAGGGTGG - Intronic
1170545592 20:17433505-17433527 CAACAGGAGCAGAGGCAGAGAGG + Intronic
1170556780 20:17521338-17521360 CAGCATGAAGAAATGCATGGTGG + Intronic
1170658621 20:18315161-18315183 AAGCATGTGAAGATCCAGGGGGG - Exonic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172634150 20:36398369-36398391 CAGCATGGGCAAAGGCATGGAGG + Intronic
1172808235 20:37628648-37628670 CAGCATGTGCAAATGCAAGGAGG - Intergenic
1172867697 20:38112720-38112742 CATCGCGGGCAGATGCAGGGAGG - Intronic
1172892896 20:38279532-38279554 CAGCATGAGCAGAGGTTTGGAGG + Intronic
1172962771 20:38810188-38810210 CAGCATGTGCAGAGGCACCGAGG + Intronic
1173301448 20:41807224-41807246 AAGCGTGAGCCGAAGCAGGGCGG - Intergenic
1173541337 20:43854034-43854056 CAGCAGCCGCAGATGCAGGACGG - Intergenic
1173576392 20:44115365-44115387 GAGCCTGAGCAGCTGGAGGGTGG - Intronic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1174104991 20:48155586-48155608 AAGCAGGAACAGATGCATGGCGG + Intergenic
1174160195 20:48545173-48545195 CAGGATTAGCAGATGCTGGAAGG - Intergenic
1174171365 20:48620013-48620035 CAGCAGGGCCAGCTGCAGGGTGG + Intergenic
1174574343 20:51526071-51526093 CGGGCTGAGCAGATGCAGGAAGG - Intronic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175836730 20:62000843-62000865 CAGCAGGTGCAGGTGCGGGGAGG - Intronic
1178281956 21:31291438-31291460 CAGCAGGATCAGATGCAGATGGG - Intronic
1178350049 21:31866346-31866368 CAGCAGGTGGAGATGCAGTGAGG - Intergenic
1179637757 21:42724303-42724325 CAGCAATAGCAGAGGCAGGCAGG + Intronic
1180203392 21:46241143-46241165 CAGCATGAGCTGTTCCAGGAGGG - Intronic
1181314690 22:21963712-21963734 CAGCAGGTGCTGTTGCAGGGAGG - Intronic
1181343510 22:22200854-22200876 CTGCAGGAGCATATGGAGGGTGG - Intergenic
1181761995 22:25065074-25065096 CTGCCTGAGCATAGGCAGGGAGG + Intronic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1182700860 22:32237044-32237066 CAGCATGAGGAAATGGATGGTGG - Intronic
1183288356 22:36982137-36982159 CCTCATGAGGAGATGCAGGGAGG - Intergenic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183717969 22:39545250-39545272 CAGCATGTGCAGAGGCCTGGAGG + Intergenic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184668634 22:46001522-46001544 CAGCTGGAGCAGGTGCAGTGAGG - Intergenic
1185038723 22:48493201-48493223 CAGCACGAGCAGGTGGATGGTGG + Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
950015020 3:9749383-9749405 AAGCATGAGCAGATGGAGTATGG + Intergenic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950433315 3:12964144-12964166 CTGCATGAGCTGCTGCAGAGAGG - Intronic
950635203 3:14309174-14309196 CAGCAAGAGCAAAGACAGGGAGG + Intergenic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
950900783 3:16495621-16495643 CAGCAAGAGCAAAGGCATGGAGG + Intronic
951135879 3:19103707-19103729 GAGGATGAGCAGAATCAGGGTGG - Intergenic
951254582 3:20433409-20433431 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
951469145 3:23036404-23036426 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
952514035 3:34085681-34085703 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
953419271 3:42742031-42742053 CAGCATGAAGAGGTGCAGGCAGG - Intronic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954130858 3:48560228-48560250 CAGCATGTGCAGAGACAGGCAGG + Intronic
954608961 3:51934232-51934254 CAGCATGGGGAGAGGCATGGAGG - Intronic
954681253 3:52347250-52347272 CAGCATGGGCAGAGGCACCGAGG + Intronic
955630341 3:60966403-60966425 GAGCATGAGCCAAAGCAGGGCGG - Intronic
956048384 3:65220701-65220723 GAGGATGAGCGGAAGCAGGGTGG - Intergenic
957576743 3:82017261-82017283 GAGCATGAGCAAAGGCAGTGAGG + Intergenic
958087302 3:88826657-88826679 CAGCATGGGCATATTGAGGGTGG - Intergenic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
959024955 3:101230597-101230619 GAGCATGAGCAAAGTCAGGGAGG - Intronic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
960541447 3:118866242-118866264 CAGCTGAAGCACATGCAGGGAGG - Intergenic
960673814 3:120176111-120176133 CATCATGACCAGAGGCAGGGAGG - Intronic
960674507 3:120181347-120181369 CAGCAGGAGCAGACCCTGGGGGG + Exonic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960823003 3:121754262-121754284 AAGCATGAGCCAATGCGGGGGGG + Intergenic
960916834 3:122703386-122703408 CAGCATGAACATAGGCATGGTGG - Intronic
961476853 3:127152429-127152451 CAGCATGTGAAGATGCAAGAAGG - Intergenic
961752182 3:129103207-129103229 CAGCTAGGGCAGATGCAGTGGGG - Intronic
961984890 3:131121950-131121972 GAGCGTGAGCTGAAGCAGGGCGG - Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962410853 3:135140730-135140752 CTGCTTGAGCAATTGCAGGGAGG + Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963043137 3:141083603-141083625 CAGCACAAGCAGAAGCATGGAGG - Intronic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
963464417 3:145660687-145660709 CAGCATGTGCAAATGCACAGAGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
964902030 3:161671210-161671232 CAGCAGGAGCAGTTGTAGGTAGG + Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966902698 3:184498588-184498610 AAGCTTGGGCAGTTGCAGGGGGG - Intronic
966921341 3:184613607-184613629 CAGGATGTGCAAATGCAGAGAGG + Intronic
967007752 3:185400243-185400265 CAGGGTGCGCAGACGCAGGGAGG - Intronic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
968963201 4:3756109-3756131 CTGCATGAGAACTTGCAGGGTGG + Intergenic
969061225 4:4436869-4436891 CAGCATGAGCAAATGCTCAGAGG - Intronic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
969199319 4:5590065-5590087 CAGCATGACCAGAGGCACTGAGG + Intronic
969238548 4:5885178-5885200 CAGCATGGGCAAAGGCAAGGAGG - Intronic
969278240 4:6151442-6151464 CAGCTTGGGCAGAGGCATGGAGG - Intronic
969507779 4:7598836-7598858 CAGCATGAGCACAGCCTGGGGGG - Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969827526 4:9769302-9769324 CAGCCTGAGGAGATGCTTGGTGG + Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970714389 4:18904739-18904761 GAGCATGGGCACATGCAAGGTGG - Intergenic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
970984341 4:22138598-22138620 TAGCATGAGCAGATCCTTGGAGG + Intergenic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972688971 4:41378109-41378131 GAACATGAGCAGAGGCATGGAGG + Intronic
972820660 4:42698172-42698194 CAGCTTGAGGAGATTCTGGGCGG + Intergenic
973720560 4:53719698-53719720 CAACATGAACAAAGGCAGGGAGG - Intronic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
975076332 4:70213192-70213214 GAGCATGAGCTGAAGCAGGGCGG - Intergenic
975254329 4:72216111-72216133 CAAGATGACCAGCTGCAGGGAGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975634341 4:76431717-76431739 CACCATAAGCAGATGCAGCCAGG - Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
977004316 4:91545292-91545314 GACCATGAGCCGAAGCAGGGCGG - Intronic
977288696 4:95139901-95139923 CAGTGTGAGCCGAAGCAGGGTGG - Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
982110024 4:152045567-152045589 CAGCAGGTGCTGATGCATGGGGG - Intergenic
982650431 4:158081662-158081684 CTGCAGGAGCAGCTGCAGGCAGG - Intergenic
982652144 4:158099515-158099537 GAACAAGAGCAGAAGCAGGGAGG - Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983362352 4:166743630-166743652 GAGTATGAGCCGAAGCAGGGCGG + Intronic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985714549 5:1448097-1448119 CAGGAAGTGCAGAGGCAGGGGGG - Intergenic
986229523 5:5849947-5849969 CTGCATGAGCTAATGCCGGGGGG - Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986658514 5:10038504-10038526 AAGCCTGAGCAAATGCAAGGAGG - Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988495450 5:31741762-31741784 CAGCATGAGAGTATGCACGGGGG - Intronic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989225364 5:39021591-39021613 GAGCATGAGCACAAGCAAGGTGG - Intronic
989345331 5:40423184-40423206 GAGGATGAGCCGAAGCAGGGCGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991501285 5:67279785-67279807 CAGCGTGAGGCGCTGCAGGGTGG - Intergenic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992241528 5:74774700-74774722 AACCATGAGCAGAGGAAGGGAGG + Intronic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
992886801 5:81167630-81167652 CCCCATGAGCAGCTGCAGGCAGG + Intronic
993069057 5:83135189-83135211 GAGCATGAGCCGAAGCAGGGTGG - Intronic
993168820 5:84389434-84389456 CAGCATGAGCAGAGGGTTGGAGG - Intergenic
993757712 5:91751497-91751519 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994178997 5:96743474-96743496 CAGCCTGAGCTGATGGAGGTGGG - Intronic
994350230 5:98737357-98737379 GAGCATAAGCTGAAGCAGGGTGG + Intergenic
994794054 5:104270845-104270867 TAGCATGAGCAAATGCAGAGAGG + Intergenic
994946807 5:106404605-106404627 CAGTAGCAGGAGATGCAGGGAGG + Intergenic
995376467 5:111479908-111479930 AGGCATGAGAAGAGGCAGGGAGG - Intronic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996477831 5:123941541-123941563 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
996773577 5:127110407-127110429 CAGAAGGAGCAGTTTCAGGGAGG - Intergenic
997459620 5:134043034-134043056 CAGCAGGGGCAGATCCAGGGAGG + Intergenic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
998308502 5:141102616-141102638 CACCAGGAGCACATGCAGCGTGG - Exonic
998623761 5:143822987-143823009 CAGCATGAGCAAAGGCCTGGAGG + Intergenic
998639931 5:143997849-143997871 CAGCAAGATCAGATGCTGAGGGG + Intergenic
999330695 5:150671853-150671875 CAGCAGGGGCGGCTGCAGGGTGG - Exonic
999516995 5:152311374-152311396 CAGCATAAGCAGATCAAGGAGGG - Intergenic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
1000412362 5:160947051-160947073 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
1001236171 5:170031422-170031444 CAACAGGAGCAGAAGCAGTGTGG + Intronic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1001523589 5:172413169-172413191 CATCATGCGCAGCTGCAGGCTGG + Intronic
1001875198 5:175194303-175194325 CAGCATGGGCAAAGGCAGGGAGG + Intergenic
1001883878 5:175270909-175270931 CAGCATGTGCAAAGGCATGGGGG + Intergenic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1002468366 5:179419768-179419790 CCGCGGGAGCAGTTGCAGGGAGG + Intergenic
1002571326 5:180140835-180140857 CAGCATGTGCAGAGGCTCGGCGG + Intronic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1003044103 6:2717071-2717093 CAGTATGAGCAGAAACAGGTTGG + Intronic
1003352717 6:5333616-5333638 CACCTTGAGCAGAGGCAGGCAGG + Intronic
1004863326 6:19829046-19829068 CAGCATGTGCAGAAGCTTGGAGG - Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006582295 6:35083982-35084004 CAAAATGAGAAGATGAAGGGGGG + Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1006818754 6:36873715-36873737 CAGCATGAGCAAATAGAGAGAGG + Intronic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1007228196 6:40329305-40329327 CAGCATGAGCAGAGGTTGGGAGG + Intergenic
1007968924 6:46030711-46030733 CAACATGAGCAAAGGCATGGAGG - Intronic
1009239219 6:61163570-61163592 GTGCATGAGCCGAAGCAGGGTGG - Intergenic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1009606897 6:65882006-65882028 AAGCATGAGAAGATGCATGTGGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1010033347 6:71291639-71291661 GAGCAGGAGCAGATGCTGGCAGG + Intronic
1010142543 6:72627784-72627806 CAGCATGAGCAAACACATGGTGG - Intronic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010671699 6:78694469-78694491 GAGCATGAGCTGAAGCAGGGCGG + Intergenic
1010884068 6:81215349-81215371 CGGGATGACCAGCTGCAGGGAGG + Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012799010 6:103801997-103802019 GAGCATGAGCCGAAGCAGGGCGG + Intergenic
1012933194 6:105338564-105338586 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013152966 6:107464247-107464269 CAGAATGACCAGGTGCTGGGTGG + Intergenic
1013584137 6:111563689-111563711 CAGCATGAGCAAATGTCTGGAGG + Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015951160 6:138554003-138554025 CAGTATGTCCAGATGGAGGGAGG + Intronic
1016875911 6:148864468-148864490 GAGCATGAGCCGAAGCAGGGCGG - Intronic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018766857 6:166940831-166940853 CACCAAGAGCAGATGCAGCCAGG + Intronic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1019321137 7:415839-415861 CAGCATGAGGAGTTTCAGGAAGG - Intergenic
1019989709 7:4682847-4682869 CTGCTTGGGCAGCTGCAGGGCGG - Exonic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022226723 7:28371168-28371190 CAGCAGCAGAAGATTCAGGGAGG + Intronic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023733467 7:43214730-43214752 AGGCATGAGCAGATGCAGGTGGG + Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024015684 7:45312141-45312163 CAGCAGTGGCAGATGCAGGCAGG + Intergenic
1026390328 7:69894812-69894834 AAGCATGAGCAAATGAAGAGTGG - Intronic
1026467592 7:70667965-70667987 CTGCCTGAGCAGGTCCAGGGTGG + Intronic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029479829 7:100805617-100805639 CAGCATGAGCTGGTGGAGGGAGG + Exonic
1029698082 7:102227717-102227739 CAGGAGGAGCAGGTGAAGGGCGG + Intronic
1029727368 7:102415948-102415970 CAGCCTAAGCACATGCAGCGAGG - Intronic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1030047730 7:105512554-105512576 CAGCATGTGCAAAGGCATGGGGG + Intronic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1030097077 7:105909943-105909965 CCACTTGAGCAGAGGCAGGGAGG + Intronic
1030142568 7:106320319-106320341 GAGCATGAGCCAAAGCAGGGAGG + Intergenic
1030462158 7:109853201-109853223 GGGCAAGAGCAGAAGCAGGGTGG - Intergenic
1030771178 7:113476204-113476226 TAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034051475 7:147988708-147988730 CAGCATCCCCAGATGCAGGCGGG + Intronic
1034065632 7:148133947-148133969 CAGCATAGGCAAATGCAGGTGGG + Intronic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034413770 7:150954676-150954698 CAGAATGTGCAGATGTGGGGTGG + Intronic
1034417193 7:150971375-150971397 CAGCATCAGCTGTTGCAGTGGGG + Intronic
1034658817 7:152751351-152751373 GAGCAGGCACAGATGCAGGGAGG - Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1034811645 7:154137625-154137647 CAGCAGGAGGAGATGGTGGGGGG + Intronic
1034943203 7:155245222-155245244 GAGGATGAGCTGATGCAGGCAGG - Intergenic
1035040081 7:155920859-155920881 CAGAAGGAGCTGATGCTGGGTGG + Intergenic
1035325018 7:158060150-158060172 CACCATGTGCAGATGGAGTGTGG - Intronic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1036690782 8:10943489-10943511 CAGCAGGAGCAGATACAGAGAGG - Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1037676126 8:21052142-21052164 CAGCAGGAGCAGTTCCATGGTGG - Intergenic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1037842620 8:22256073-22256095 CAGCGGGATCAGATGCAGGTGGG + Intergenic
1037996980 8:23359860-23359882 CAGCATGGGCAGAGGCACAGAGG - Intronic
1038546327 8:28428253-28428275 CTGCATGAGCAGTTGAATGGAGG - Intronic
1040560613 8:48520474-48520496 CAGAGTGAGCAGGTGCCGGGCGG - Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1041393298 8:57367049-57367071 CAGCGGGAGCAGAGGCAGTGTGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044927892 8:97224641-97224663 CAGGTGGAGCAGCTGCAGGGAGG + Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1045088161 8:98710318-98710340 GAGCATGAGCTGAAGCAGGGCGG + Intronic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046794336 8:118354416-118354438 TAGCATGAGCAAAGGCTGGGAGG - Intronic
1046861947 8:119102772-119102794 CAGCCTGACCAGATGCAGACAGG + Intronic
1046900745 8:119521145-119521167 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1047351208 8:124076357-124076379 CAGCAGGAGCAAATGCAGAAAGG - Intronic
1047930939 8:129727933-129727955 CAGCAATGGCATATGCAGGGGGG - Intergenic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1049095241 8:140544717-140544739 CAGCATGGGCAGACGCTGAGAGG + Intronic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1050478718 9:6067645-6067667 CAGCATGAGCACATAAAGGCTGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051707465 9:19895761-19895783 CCGCATGAGGAGATGGAGGGTGG - Intergenic
1051750083 9:20332067-20332089 AAGCATGAGGGGAAGCAGGGTGG - Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1052610619 9:30768928-30768950 CAGCATGGGCAAAGGCATGGGGG + Intergenic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052799281 9:32952667-32952689 CAGCTGGAGCAGGAGCAGGGTGG + Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053150949 9:35742390-35742412 AAGCATGAGCACAGGCATGGAGG - Intronic
1053195731 9:36116943-36116965 CACCATGAGCCAATGTAGGGAGG - Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1053576975 9:39363610-39363632 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1053582926 9:39425791-39425813 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1053841482 9:42191535-42191557 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1053847109 9:42250656-42250678 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1054098545 9:60922300-60922322 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1054104505 9:60984534-60984556 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1054119945 9:61197929-61197951 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1054587811 9:66984633-66984655 CAGCAAGGGAAGATGCAGGCAGG - Intergenic
1054876335 9:70100383-70100405 CAGCAGGACCTGATCCAGGGAGG + Intronic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055710981 9:79061855-79061877 CAGAATGAGCAAATGCCTGGAGG + Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057861868 9:98647020-98647042 CACAATGAGAAGAGGCAGGGAGG + Intronic
1058086737 9:100755798-100755820 CAGCAAGAGCAAAGGCATGGAGG - Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058426190 9:104876876-104876898 TGGCAGGAGCAGATGCAGGTGGG + Intronic
1059323347 9:113486327-113486349 AAGCATGAGCAAAGGCAAGGAGG + Intronic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1059877625 9:118653278-118653300 AACCATGAGCAGAAGCATGGAGG + Intergenic
1060733734 9:126053335-126053357 CAGCATGGGCAAAAGCAAGGAGG - Intergenic
1060775741 9:126372891-126372913 CAACACGAGCAAAGGCAGGGAGG + Intronic
1060922777 9:127434132-127434154 CACCATGAGCAGAAGCATGGAGG - Intronic
1061355836 9:130104214-130104236 CGGCCTGTGCAGATTCAGGGGGG + Intronic
1062341939 9:136097605-136097627 CAACAAGATCAAATGCAGGGAGG - Intergenic
1062370928 9:136238334-136238356 GAGCATGAGAGGGTGCAGGGAGG - Intronic
1203488695 Un_GL000224v1:83229-83251 AACCATGTGCATATGCAGGGAGG - Intergenic
1203501316 Un_KI270741v1:25124-25146 AACCATGTGCATATGCAGGGAGG - Intergenic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1203613363 Un_KI270749v1:28641-28663 CCGCATCAGCAAATGCAGGAGGG - Intergenic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188868372 X:35342983-35343005 CAGCATGAACAGAAAAAGGGGGG + Intergenic
1189194779 X:39143725-39143747 AAGGACGAGCAGATGGAGGGAGG - Intergenic
1189398797 X:40646698-40646720 CATCATGAGCACAGGCAGGGAGG - Intronic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1190481932 X:50885744-50885766 CAGCATGAGAAATGGCAGGGAGG + Intergenic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1190912683 X:54787248-54787270 CAGCATGTGCAGAGGCACAGAGG - Intronic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191024202 X:55896238-55896260 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1192609157 X:72550357-72550379 CAGCATGTGCAGATGCTTAGAGG - Intronic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192949176 X:75998100-75998122 GAGCATGAGCTGAAGCAGGGTGG - Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193571597 X:83151536-83151558 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194961132 X:100236775-100236797 GAGAATGAGCCGAAGCAGGGTGG - Intergenic
1194975377 X:100390858-100390880 CAAAATGAGCAGAGGCATGGTGG + Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1196476518 X:116092469-116092491 GAGGGTGAGCAGACGCAGGGTGG - Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197926853 X:131656071-131656093 TAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198152243 X:133922570-133922592 CAGCAGGAGTGGGTGCAGGGTGG + Intronic
1198592370 X:138198452-138198474 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199781208 X:151061690-151061712 CAGCAGGAGCAGAAACATGGTGG - Intergenic
1199970399 X:152855712-152855734 GGCCATGAGCAGAGGCAGGGAGG - Intronic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic