ID: 1107731252

View in Genome Browser
Species Human (GRCh38)
Location 13:43351276-43351298
Sequence GAGATTGCATGTGTGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107731252_1107731258 18 Left 1107731252 13:43351276-43351298 CCCCAAAACACACATGCAATCTC 0: 1
1: 0
2: 3
3: 37
4: 341
Right 1107731258 13:43351317-43351339 GTAAAAATGAGAAAATTAAGGGG 0: 1
1: 0
2: 7
3: 120
4: 1611
1107731252_1107731256 16 Left 1107731252 13:43351276-43351298 CCCCAAAACACACATGCAATCTC 0: 1
1: 0
2: 3
3: 37
4: 341
Right 1107731256 13:43351315-43351337 CTGTAAAAATGAGAAAATTAAGG 0: 1
1: 0
2: 13
3: 190
4: 1447
1107731252_1107731257 17 Left 1107731252 13:43351276-43351298 CCCCAAAACACACATGCAATCTC 0: 1
1: 0
2: 3
3: 37
4: 341
Right 1107731257 13:43351316-43351338 TGTAAAAATGAGAAAATTAAGGG 0: 1
1: 0
2: 12
3: 155
4: 1358
1107731252_1107731259 19 Left 1107731252 13:43351276-43351298 CCCCAAAACACACATGCAATCTC 0: 1
1: 0
2: 3
3: 37
4: 341
Right 1107731259 13:43351318-43351340 TAAAAATGAGAAAATTAAGGGGG 0: 1
1: 0
2: 5
3: 174
4: 2577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107731252 Original CRISPR GAGATTGCATGTGTGTTTTG GGG (reversed) Intronic
903834886 1:26197501-26197523 GAGAGTACACGTGTGTTTTGTGG + Intronic
904818350 1:33222015-33222037 GAGGTAGTATGTGTGTTCTGAGG + Intergenic
905411786 1:37775359-37775381 CAGATTGGATTTTTGTTTTGGGG + Intergenic
906475855 1:46168848-46168870 GAGATAGTGTGTGTGTGTTGAGG - Intronic
906785079 1:48608452-48608474 GAGATTGCATGTGAGGATTATGG + Intronic
906786441 1:48619994-48620016 ATGTGTGCATGTGTGTTTTGGGG - Intronic
907668466 1:56453300-56453322 GAGCTCACATGTGTGTGTTGAGG - Intergenic
910611636 1:89150216-89150238 GAGATAACATCTGTGTTATGAGG - Intronic
910775477 1:90870626-90870648 GAGTTTTCTTGTGTGTTGTGAGG - Intergenic
910811457 1:91241713-91241735 GGGATTGCATATATGTTCTGGGG + Intergenic
912422466 1:109553621-109553643 GAGGATGCATCTGTGTTTCGGGG + Intronic
912439814 1:109689195-109689217 GAGATTGAGTCTGTGTTTTGTGG + Intronic
912443130 1:109713631-109713653 GAGATTGAGTCTGTGTTTTGTGG + Intronic
912493081 1:110072897-110072919 TAGATTACATGAGAGTTTTGTGG + Intronic
914912388 1:151798117-151798139 GAGATTAAATGTGTTTCTTGAGG + Intergenic
915231946 1:154452195-154452217 GAGCTTGGATTTGTGTTTTAAGG - Intronic
917182038 1:172309075-172309097 GAGATTGCATATGTGTTTTATGG - Intronic
917776041 1:178335541-178335563 GAGAGTGTGTGTGTGTTTTAAGG - Intronic
918391659 1:184070242-184070264 GTGTTTGTATGTGTGTGTTGGGG - Intronic
918451097 1:184660353-184660375 GAGATTTCATGTTTGTTTTATGG + Intergenic
918492956 1:185102248-185102270 GTGTGTGGATGTGTGTTTTGGGG + Exonic
920253992 1:204641998-204642020 GTGAGTGCATGTGTGTGTTAGGG + Intronic
920440029 1:205974340-205974362 GTGTTTGCATGTGTGGTGTGTGG - Intergenic
920647014 1:207811400-207811422 GAGAATGCAGCTGTGGTTTGAGG - Intergenic
920703933 1:208238165-208238187 GAGAGAATATGTGTGTTTTGCGG + Intronic
920855862 1:209661036-209661058 GAGATGGCATGTGTGCTTCTTGG + Intergenic
921188360 1:212688931-212688953 GAATTTGCATGTGTCTTTGGGGG - Intronic
921528521 1:216249689-216249711 GAGAATGTAGGTGTGTTTAGTGG - Intronic
922576898 1:226666859-226666881 GAGAGTCCATGTGTGGTCTGTGG - Intronic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
923799290 1:237191395-237191417 GAGATTGCATTTGAATTTTATGG + Intronic
1062829888 10:598429-598451 ATGATTGCATGTCGGTTTTGTGG - Intronic
1066621127 10:37351809-37351831 GAGATTGCATTTATGGATTGAGG - Intronic
1068802020 10:61152194-61152216 GAGTGTTCAGGTGTGTTTTGGGG + Intergenic
1069195177 10:65542641-65542663 GAGATCATATCTGTGTTTTGTGG - Intergenic
1071440455 10:85687840-85687862 GGAACTGAATGTGTGTTTTGGGG + Intronic
1071447441 10:85761816-85761838 GAAAGTGTGTGTGTGTTTTGGGG - Intronic
1072015298 10:91340895-91340917 TAGATGGTGTGTGTGTTTTGGGG + Intergenic
1072093924 10:92158512-92158534 GAGAGTGTGTGTGTGTTTGGGGG - Intronic
1072918436 10:99555241-99555263 CAGATTGATTGTGTGTGTTGGGG + Intergenic
1073352032 10:102826846-102826868 AAGAGTGCATATGTGTGTTGGGG - Intergenic
1075654860 10:124154498-124154520 GAGTGTGCATGTGTGTGTGGGGG - Intergenic
1076065339 10:127443848-127443870 CACCTAGCATGTGTGTTTTGGGG + Intronic
1076481905 10:130790252-130790274 GAGTTTGTATGTGTGGGTTGAGG - Intergenic
1076481912 10:130790304-130790326 GAGTTTGTATGTGTGGGTTGAGG - Intergenic
1076481918 10:130790356-130790378 GAGTTTGTATGTGTGGGTTGAGG - Intergenic
1076503405 10:130954871-130954893 GAGCTTTCCTGTGGGTTTTGAGG - Intergenic
1076602766 10:131669679-131669701 GGGATTCAATATGTGTTTTGTGG + Intergenic
1076903073 10:133349474-133349496 GTCTGTGCATGTGTGTTTTGTGG - Intronic
1077905157 11:6526976-6526998 GTGATGCCATGTGTGTTTTGAGG + Intronic
1078747759 11:14131719-14131741 GAGATTGAATGACTGGTTTGTGG + Intronic
1079041177 11:17061364-17061386 GAATTTGCTTGTGTTTTTTGAGG - Intergenic
1079464281 11:20713947-20713969 CAGTTTGCATGTATGTTTGGAGG + Intronic
1079969091 11:27014551-27014573 AAGATTGCAGTTGTCTTTTGGGG + Intergenic
1081546845 11:44077773-44077795 GAGAGTTCATATGTATTTTGGGG + Intronic
1084919019 11:72454122-72454144 GAGGTTGCATGTGTGAATTAAGG - Intergenic
1086375741 11:86199099-86199121 GAGAGACCATGTGTGTGTTGGGG + Intergenic
1087024717 11:93638331-93638353 GAGAATGCATTAGTATTTTGAGG - Intergenic
1087655094 11:100912941-100912963 GATATTTCAGGTGTCTTTTGTGG + Intronic
1087710466 11:101543869-101543891 TAGATCGCATTTGTGTTTTTTGG - Intronic
1087738859 11:101864825-101864847 GAGGTTCTGTGTGTGTTTTGGGG - Intronic
1088141990 11:106628346-106628368 GAGATGGCATTTGTGATTTATGG + Intergenic
1088588536 11:111380435-111380457 GGAATTGCATGGGTGTTTGGTGG - Intronic
1088890970 11:114043894-114043916 GAGATTCCATTTGTGTGTTATGG - Intergenic
1088950660 11:114566667-114566689 GATATTACATGTGTCTCTTGAGG - Intergenic
1089125121 11:116171481-116171503 GTGGTGGCATGTGTGTGTTGGGG + Intergenic
1089874582 11:121707550-121707572 GCAATAGCATTTGTGTTTTGGGG + Intergenic
1090772708 11:129935476-129935498 GAAGTTGTGTGTGTGTTTTGAGG - Intronic
1091053237 11:132394154-132394176 GAGGTTACAAGTGTGGTTTGAGG - Intergenic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092632830 12:10402290-10402312 GCAAGTGCATGTGTCTTTTGGGG - Intronic
1092782776 12:12002806-12002828 TAGATTCAAAGTGTGTTTTGTGG + Intergenic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1092982217 12:13808115-13808137 AAGATTGCATGAGTGCTTTTGGG + Intronic
1093469744 12:19487909-19487931 GAGATCTCATGTTTGTTTTGTGG + Intronic
1095373209 12:41495175-41495197 GAGATTGAATGTGTTTATGGTGG + Intronic
1095528740 12:43159511-43159533 TATATTGCAATTGTGTTTTGGGG - Intergenic
1095877419 12:47097270-47097292 GTAATTAAATGTGTGTTTTGAGG - Intronic
1098331090 12:69354547-69354569 GAGGCTGAATGTGTGTCTTGAGG - Intergenic
1098371390 12:69764070-69764092 GTGAGTGCATGTGTCTTTTTGGG + Intronic
1098758856 12:74398593-74398615 GAAATTGTATGTGCGTGTTGAGG + Intergenic
1099630116 12:85132039-85132061 TACATAGCATGTGTGTTTTCTGG - Intronic
1100221147 12:92505745-92505767 GCGCGTGCGTGTGTGTTTTGGGG + Intergenic
1101618219 12:106358454-106358476 GAATTTGCCTGTGTGTTTTCTGG + Intronic
1102044079 12:109818795-109818817 GTGTGTGCATGTGTGTTTTGGGG - Intronic
1103143659 12:118574927-118574949 GAGATTTCAGGTCTTTTTTGTGG - Intergenic
1104282347 12:127389621-127389643 AACATTGTATGTGTGTTTGGAGG + Intergenic
1106386052 13:29287258-29287280 TAGATTGCATGTGTGTGAAGGGG + Intronic
1107731252 13:43351276-43351298 GAGATTGCATGTGTGTTTTGGGG - Intronic
1109554918 13:63960225-63960247 TAGATTGCATGTTTGATGTGGGG + Intergenic
1109570901 13:64188255-64188277 CAGATTTGAGGTGTGTTTTGAGG - Intergenic
1109955141 13:69556190-69556212 GAGAATGCAAGTTTGCTTTGAGG + Intergenic
1110108276 13:71708447-71708469 GAGATTGCATGTTTTATTTTGGG + Intronic
1110548520 13:76784073-76784095 GCGATGGCATGTGACTTTTGAGG - Intergenic
1111065308 13:83083648-83083670 GAGATTTCATTTGTGGTTTATGG - Intergenic
1111490100 13:88961130-88961152 GAGATTCCATGTGTGTCTGTTGG + Intergenic
1111529655 13:89520326-89520348 GAGATTACGTGTGTGGTTTATGG + Intergenic
1112092787 13:96099836-96099858 GAGATGGCATCTGTATTTTGTGG + Intronic
1112151458 13:96769121-96769143 CAGATTGTGTGTGTGTTTGGTGG - Intronic
1112155344 13:96810753-96810775 GAGCTTGCATGTGTGTTAAGGGG + Intronic
1113697695 13:112358310-112358332 GAATGTGCATGTGTGTTGTGGGG + Intergenic
1114187991 14:20417858-20417880 GACATTTCAGCTGTGTTTTGAGG + Intergenic
1114233962 14:20808386-20808408 GATATTGTATGTCTGTTTTCAGG + Intergenic
1114808873 14:25872044-25872066 CACATTGCATGTGTGCTTTTAGG - Intergenic
1114977985 14:28125620-28125642 GGGTTTGCATTTCTGTTTTGAGG + Intergenic
1115201061 14:30854610-30854632 CAGATTGGATGTGGGTGTTGAGG - Intergenic
1116057753 14:39885202-39885224 GAGAATGCTTCTGTGTTCTGAGG + Intergenic
1118134574 14:63008719-63008741 CAGCTTGCAGGTGTGCTTTGAGG - Intronic
1120441395 14:84545460-84545482 GACAATGCATGTTTCTTTTGCGG + Intergenic
1121535476 14:94687645-94687667 CAGGTTCAATGTGTGTTTTGGGG - Intergenic
1123916956 15:25040872-25040894 GAAATTGTTTGTGTGTGTTGTGG + Intergenic
1125770616 15:42163210-42163232 GATCTTGCATGTGTGTATTGAGG - Intronic
1126434636 15:48623920-48623942 GAGAGAGAATGTGTGTGTTGGGG - Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127978685 15:64018098-64018120 GAGAAAGGATGTATGTTTTGGGG - Intronic
1128937572 15:71760226-71760248 GACATTTCATTTGTGTTTTAGGG + Intronic
1130296658 15:82651396-82651418 GAGTTTGTTTGTTTGTTTTGAGG + Intergenic
1130928530 15:88403366-88403388 GAGATCGTGTGTGTGTGTTGGGG - Intergenic
1131315900 15:91337173-91337195 GAGAATGAATGTGAGCTTTGGGG + Intergenic
1131476709 15:92746188-92746210 GAGAGTGACTGTGTGTGTTGAGG - Intronic
1131619459 15:94052156-94052178 GTGAGTGCATGTGTGTGTGGGGG - Intergenic
1132210926 15:100021476-100021498 GAGATTACATGTTTGTTTTTGGG - Intronic
1133743137 16:8666563-8666585 GAGATTTCATGAGTGTTAAGTGG - Intergenic
1134909791 16:18014800-18014822 GAGAATGTGTGTGTGTTATGGGG + Intergenic
1134914540 16:18058948-18058970 TAGGTTGCATGTGTGTTTGAGGG + Intergenic
1135860430 16:26051175-26051197 GAGATTGCAAATGGGTTTGGAGG - Intronic
1138027966 16:53537734-53537756 GAGATGAGATGTGTGTTTTGGGG - Intergenic
1138927576 16:61611163-61611185 GTGTATGCATGTGTGTTTTGGGG - Intergenic
1140559982 16:75968078-75968100 GTGAGTGTGTGTGTGTTTTGTGG - Intergenic
1140567071 16:76055981-76056003 GAGATGGAATATGTGTTTTTGGG - Intergenic
1141630011 16:85282457-85282479 GAGTTCTCATGTGTGTTTTGGGG + Intergenic
1142666269 17:1465599-1465621 GAGATTGCAGGTGGGCTTCGGGG + Exonic
1142679096 17:1535132-1535154 GTGACTGCGTGTGTGTGTTGTGG - Intronic
1143572648 17:7770008-7770030 GTGATTCATTGTGTGTTTTGTGG + Intronic
1143906969 17:10216638-10216660 AAAATTGCATTTTTGTTTTGAGG - Intergenic
1144292564 17:13840806-13840828 GAGTTTGGCTGTGTGTATTGTGG - Intergenic
1144791572 17:17862517-17862539 GAGAGTGTGTGTGTGTTTGGGGG + Intronic
1145048335 17:19637700-19637722 GAGATTCCATATGTGTTTTAGGG - Intergenic
1145071524 17:19813132-19813154 AAGATTGGATGAGTCTTTTGGGG + Intronic
1147779585 17:42930940-42930962 GTGTGTGTATGTGTGTTTTGGGG - Intergenic
1148217804 17:45843216-45843238 AAAATTACATGTGTGTTGTGGGG + Intergenic
1148784453 17:50139212-50139234 GTGCGTGCATGTGTGTGTTGAGG - Intronic
1149051895 17:52314887-52314909 GAGTGTGTATGTGTGTGTTGAGG - Intergenic
1149712026 17:58752161-58752183 GCAAGTGCATGTGTGTTTGGTGG + Intergenic
1150647086 17:66985629-66985651 GAGACTGCATGTGTGCATTCAGG - Intronic
1152366338 17:79858832-79858854 GAAATTTCATGTGTGTTTAGCGG - Intergenic
1152998652 18:432643-432665 GTGTGTGCATGTGTATTTTGTGG - Intronic
1153539545 18:6139480-6139502 GTGTGTGCATGTGTGTTTAGGGG - Intronic
1153953745 18:10078477-10078499 AATATTGCAAGTGTGTTTTGGGG + Intergenic
1156717448 18:40028174-40028196 GGGGTTGCATTTGTGTTTGGAGG - Intergenic
1156754373 18:40503812-40503834 GAGAATGCAAGTGTGAGTTGAGG - Intergenic
1157204120 18:45684123-45684145 GGGAGTGCATGTGTGCTTGGAGG - Intergenic
1157349559 18:46872484-46872506 GAGCAAGCATATGTGTTTTGGGG - Intronic
1157368313 18:47086724-47086746 GATCTTCCATGTGTGTTTTACGG + Intronic
1157421669 18:47552991-47553013 GTGTGTGCATGTGTGTATTGAGG + Intergenic
1157521636 18:48349407-48349429 GAGGCTGCATATGTGTTTTAGGG + Intronic
1158769052 18:60492609-60492631 GTGAATGCATGTATTTTTTGGGG + Intergenic
1160612739 18:80101217-80101239 GTTATTGCATGTCTGTTTTCAGG + Intergenic
1162065618 19:8123695-8123717 GAGATGGGAAGTGTGTTTGGGGG - Intronic
1162089344 19:8268809-8268831 GAGAGTGCCTTTGTGTGTTGGGG + Intronic
1162280282 19:9691181-9691203 GAGCTCTCATGTGTGTTTTAAGG + Exonic
1162581671 19:11535192-11535214 GTGTTTGTCTGTGTGTTTTGGGG - Intergenic
1162768103 19:12932458-12932480 GAGATGGCAGCTGTGTTGTGTGG - Intronic
1163583446 19:18151781-18151803 GTCATTGCAAGTGGGTTTTGAGG + Intergenic
1164766683 19:30777684-30777706 CAGACTGCATGTGTGTGCTGAGG + Intergenic
1167178836 19:47885692-47885714 GAGATTGCCTGGCTCTTTTGTGG + Intronic
1168524959 19:57081467-57081489 TAGATTGTGTGTGTGTGTTGGGG - Intergenic
1168524981 19:57081571-57081593 TAGATTGTATGTGTGTGTTGGGG - Intergenic
925472767 2:4180622-4180644 AAGATTGCTTGTGTATTTGGTGG + Intergenic
925802716 2:7617407-7617429 CTGATTACATTTGTGTTTTGGGG - Intergenic
928297531 2:30097349-30097371 GAAATTGTCTATGTGTTTTGTGG + Intergenic
928667752 2:33567560-33567582 GTGTGTGTATGTGTGTTTTGAGG - Intergenic
928793326 2:34985344-34985366 GGGAGAGCTTGTGTGTTTTGGGG + Intergenic
928879512 2:36082235-36082257 GAGATAGCATGTGGGTGTGGGGG + Intergenic
928949432 2:36801325-36801347 GAGAATTCGTGTGTGTCTTGAGG - Exonic
930973625 2:57427241-57427263 GAGATTGTATGTGTATTGTAAGG - Intergenic
932837866 2:75054114-75054136 GAGTTTGCATTCTTGTTTTGGGG - Intronic
932961561 2:76418358-76418380 GAGAGTGCATGTGTGTGTGATGG + Intergenic
933717401 2:85371414-85371436 GAGAGTGTGGGTGTGTTTTGGGG + Intronic
934955454 2:98614071-98614093 TAGACTGCATGTGTGGGTTGGGG + Intronic
935418073 2:102839675-102839697 TACATTGCATTTGAGTTTTGTGG - Intronic
935825911 2:106949207-106949229 GAGAATGAATGTGTGCTTTGTGG + Intergenic
936544849 2:113382197-113382219 GAGAAGGCAGGGGTGTTTTGTGG + Intergenic
937601974 2:123748473-123748495 AAGAGTGCATGTGTGAGTTGGGG + Intergenic
938669470 2:133573346-133573368 CAGATTACATGTGTGTTGAGGGG - Intergenic
939232056 2:139440639-139440661 GATATTTTCTGTGTGTTTTGCGG + Intergenic
939672646 2:145032447-145032469 GATATTGAAAGTGTGTTGTGTGG + Intergenic
939940420 2:148343235-148343257 GTGAATGCATGTGTCTTTTTGGG + Intronic
941401199 2:165032955-165032977 GTGCATGCATGAGTGTTTTGAGG - Intergenic
942384117 2:175423329-175423351 GAGAATGGAAGTCTGTTTTGAGG + Intergenic
943178364 2:184508316-184508338 TACATTGTGTGTGTGTTTTGTGG + Intergenic
943234392 2:185299830-185299852 GAGTTTGCAACTGTGTTCTGGGG + Intergenic
945644706 2:212476114-212476136 GAGTATGTATGTGTGTTTGGTGG - Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
948306286 2:236949355-236949377 GAGTTTGCATGTGTTTTGTGAGG - Intergenic
949043919 2:241861948-241861970 GAGATTGTGTGTGTGTGCTGGGG - Intergenic
1169047961 20:2551324-2551346 GAGTTTTCATGTGTGTATTTTGG + Intronic
1170304155 20:14919045-14919067 GAGGATTCATTTGTGTTTTGCGG + Intronic
1170341787 20:15336844-15336866 GATATTGCATGTGTGAGGTGAGG + Intronic
1171098844 20:22362522-22362544 GAGATTTCATATGGGTTTTAGGG - Intergenic
1171507479 20:25649994-25650016 TTGGTTGCCTGTGTGTTTTGAGG + Intergenic
1171987021 20:31667615-31667637 GAGATGGCATGCCTGTCTTGAGG - Intronic
1172156236 20:32826937-32826959 CAGATTGCATGTTTTATTTGAGG + Intronic
1173969379 20:47139853-47139875 AAGTTTGCATGTGTGTGTTGGGG - Intronic
1175265737 20:57702400-57702422 GACAAGGCACGTGTGTTTTGGGG + Intronic
1175485556 20:59343346-59343368 CAGAGTGCCTGTGAGTTTTGGGG + Intergenic
1175581254 20:60101755-60101777 GAGTTTGCATCTGTCTTTGGAGG - Intergenic
1176725069 21:10424833-10424855 GGGATTGCATGGGAGGTTTGGGG + Intergenic
1176984212 21:15417897-15417919 GAGGTCCCTTGTGTGTTTTGAGG - Intergenic
1178252958 21:31022068-31022090 ATGATTGCATTTGTGTTTTGAGG - Intergenic
1178573894 21:33767269-33767291 GACATTGCATGTGTTTCTTAGGG + Intronic
1178586453 21:33875014-33875036 GAGTCTGCATGTGTGGCTTGGGG + Intronic
1179191443 21:39125709-39125731 GTGAGTACATGTGTGTTGTGTGG - Intergenic
1179267558 21:39818038-39818060 GAGATTTCATGTTTCCTTTGGGG + Intergenic
1180950295 22:19717762-19717784 GTGTGTGCATGTGTGTTTGGTGG - Intronic
1182850358 22:33468818-33468840 GAGATTCCATGAGACTTTTGGGG - Intronic
1184565843 22:45291518-45291540 GAGTTGGAATGTGTGTTGTGTGG + Intronic
1185083932 22:48726063-48726085 CAGCTTGCATGTGTGTTTGTGGG - Intronic
949159428 3:861746-861768 GAGATAGCATATGTGATTAGAGG - Intergenic
949365445 3:3275531-3275553 GAGATTACTTGAGTGGTTTGAGG - Intergenic
950013575 3:9740896-9740918 GAGATTGCAGGTGTGTCTGCAGG - Exonic
950018269 3:9769200-9769222 GCGGGTGGATGTGTGTTTTGGGG - Intronic
950260266 3:11538165-11538187 GAGAGAGCATGGGGGTTTTGTGG + Intronic
950767051 3:15280653-15280675 CATGTTGCGTGTGTGTTTTGGGG - Intronic
951392082 3:22118417-22118439 GAGATTGCATTTGTGAGGTGAGG + Intronic
951946288 3:28140386-28140408 GAGATTACGTGTTTGTTCTGAGG - Intergenic
952748124 3:36801280-36801302 GAGTTTGCATGTGTGTGTCAGGG + Intergenic
952911545 3:38192848-38192870 TTGCTTGCATGTGTATTTTGTGG + Intronic
952987969 3:38803838-38803860 GAGACTGGATGTGAGATTTGAGG - Intergenic
953870686 3:46625017-46625039 GAAATTGCATGTATGTGTTCAGG - Intronic
956021891 3:64941883-64941905 GATATTACATGTGTTTCTTGTGG - Intergenic
959781156 3:110234746-110234768 AAGATGGCATGGGTGATTTGTGG + Intergenic
959908457 3:111736122-111736144 ATGTGTGCATGTGTGTTTTGTGG - Intronic
960486868 3:118263303-118263325 GAGATGGCATGTGGGGTGTGGGG - Intergenic
961559219 3:127717326-127717348 CTGATTTCAGGTGTGTTTTGGGG + Intronic
962038354 3:131678490-131678512 GAGAGGGCATCTTTGTTTTGTGG + Intronic
962527228 3:136247667-136247689 GAGCTTGCATGTGAGGTCTGAGG + Intergenic
962835310 3:139184444-139184466 GTGTTTGCATGTGTGCTGTGGGG + Intronic
963027111 3:140930986-140931008 GAGTTTGCTTGTTTGTTTTGAGG + Intergenic
964640952 3:158910066-158910088 GAGACTGCCTGTGTGTTGAGTGG + Intergenic
966318080 3:178671109-178671131 GTGTTTGTACGTGTGTTTTGGGG - Intronic
966723595 3:183088525-183088547 GAGAATAGATTTGTGTTTTGTGG - Intronic
967489700 3:190076166-190076188 GTGTGTGCATGTGTGTTTGGTGG - Intronic
967626351 3:191689289-191689311 GTGTATGCATGTGTGTCTTGAGG - Intergenic
968650917 4:1759961-1759983 GAGAGAGCATGTGTTTCTTGAGG + Intergenic
969478725 4:7435537-7435559 GAGTTTGCAAGTGGCTTTTGCGG - Intronic
970969597 4:21966210-21966232 GAGATGACAGGTGTGTGTTGGGG - Intergenic
971145013 4:23967135-23967157 GATATTGCATATGGCTTTTGTGG - Intergenic
972131575 4:35841928-35841950 AAGATTGCATCTGAGTTTGGAGG - Intergenic
972183090 4:36493689-36493711 ACTAATGCATGTGTGTTTTGAGG - Intergenic
973331402 4:48913354-48913376 GAGGTTTCATGTGTGTGTCGGGG + Intergenic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
975761133 4:77620969-77620991 GAGGTTGCAGTTCTGTTTTGAGG - Intergenic
975844545 4:78511300-78511322 GAGGTTCCATGTGCGTTGTGTGG + Intronic
976076825 4:81308561-81308583 GAGATTGCTTGTTGGCTTTGAGG + Intergenic
978273608 4:106921246-106921268 GAGATGTCAGGAGTGTTTTGAGG - Intergenic
978383545 4:108156500-108156522 AATTTTGCATGTGTGTTTTCTGG - Intronic
979446783 4:120823281-120823303 GATATGGCATGTCTGTTTAGAGG + Intronic
983756163 4:171339748-171339770 GTGATTGAATGTATATTTTGGGG - Intergenic
984112952 4:175643030-175643052 TAGATTGCATGTAGGGTTTGCGG - Intronic
985019678 4:185674315-185674337 CAGATTGCATGTGGGATGTGAGG - Intronic
1202769386 4_GL000008v2_random:187556-187578 GGAAATGCATTTGTGTTTTGTGG + Intergenic
985648707 5:1097395-1097417 GAGCTTGTGTGTGTGTTTTTCGG - Intronic
985795728 5:1960717-1960739 GTGTGTGCATGTGTGTTTTGGGG - Intergenic
986031025 5:3892671-3892693 GAGACAGCATATGTGTTTTGGGG - Intergenic
986170342 5:5309786-5309808 GAGAGTGCATGTGTGGGTTTAGG + Intronic
986274505 5:6261702-6261724 GAGATTGAATGTTTTTATTGGGG + Intergenic
987514188 5:18884567-18884589 GAGACTGTATGTGTGTGTTAGGG + Intergenic
987673833 5:21049130-21049152 AAGATTGCATGTGGCTTTTGGGG + Intergenic
989060474 5:37406216-37406238 GAGATTGGATGTGAGGTATGAGG - Intronic
989750771 5:44890539-44890561 GAGATTGCTGGAGTGTTTTGAGG + Intergenic
990189973 5:53249128-53249150 GGGATTGGTTCTGTGTTTTGGGG - Intergenic
990540424 5:56767101-56767123 GAGCTGGCATGTGGGGTTTGCGG - Intergenic
991192923 5:63897004-63897026 GAGATTGTAGTTGTGTTTAGGGG - Intergenic
991481294 5:67083092-67083114 AAGATTTCCTGTGTGGTTTGTGG + Intronic
991537696 5:67690852-67690874 TAGATGGTTTGTGTGTTTTGGGG + Intergenic
992268588 5:75042693-75042715 GAGCTTGCTTGTTTGTTTTCTGG + Intergenic
993147568 5:84114559-84114581 GAGATTGCTTCTTTGTATTGGGG + Intronic
994376710 5:99023110-99023132 GAGATTGTGTGTGTGTGTGGAGG + Intergenic
994743721 5:103653192-103653214 GAGATTGCATGTTCTTTGTGTGG + Intergenic
996834333 5:127774742-127774764 GAGATTTCATATGAATTTTGAGG + Intergenic
997822516 5:137078770-137078792 GAGAATGAATGTGGGCTTTGGGG - Intronic
997827172 5:137116761-137116783 CAGTGTGCATGTGTGTGTTGGGG - Intronic
998994729 5:147858767-147858789 GAGATGCCATGTGTCTTTTGAGG + Intergenic
999185882 5:149708363-149708385 GGAATTGCATGTGTGTTTTTAGG + Intergenic
999250004 5:150176884-150176906 CTGTTTGCATGTGTGTGTTGGGG + Intronic
1002259402 5:177983433-177983455 GAGAATGACTGTGTGTTTGGGGG - Intergenic
1006505830 6:34488054-34488076 GAGAGTGCAAGTGTCTGTTGTGG - Intronic
1007308150 6:40923300-40923322 GATCTGGCATGTATGTTTTGAGG - Intergenic
1008677496 6:53835795-53835817 CAGTTTTCATGTGTGTTCTGTGG + Intronic
1009732371 6:67624682-67624704 GAGATTAGTTGGGTGTTTTGAGG + Intergenic
1009752868 6:67894964-67894986 GTGATTGAATGTGTGTCTTTGGG - Intergenic
1010100544 6:72101245-72101267 GAGAATACAGGTGGGTTTTGTGG + Intronic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1010437565 6:75851653-75851675 GCGTTTGTGTGTGTGTTTTGGGG - Intronic
1010466437 6:76171968-76171990 CAGATTACATGTGTGTTTTGGGG - Intergenic
1010633141 6:78224178-78224200 GAGAGTGTGTGTGTGTTTTGAGG + Intergenic
1011431192 6:87288736-87288758 TAGATTGGATGTGGGGTTTGAGG - Intronic
1011862455 6:91776767-91776789 AAGAGTGCATGTGTCTTTTTGGG - Intergenic
1012988243 6:105897861-105897883 CAGAAAGCATGTCTGTTTTGTGG + Intergenic
1015157455 6:130112462-130112484 GAGAGTGCAGGTATGTTTTTGGG - Intronic
1016638028 6:146317205-146317227 GAGTTTTCATGGGTCTTTTGTGG + Intronic
1016873835 6:148845095-148845117 AAGAGTGCATGTGTCTTTTTTGG + Intronic
1017015711 6:150097995-150098017 GAATTTGCATTTGTGTTTTGGGG + Intergenic
1017750842 6:157489148-157489170 GAGATTCCCTGTGAGTTTTCAGG - Intronic
1018296948 6:162358146-162358168 GAAAGTGTATGTGTGTGTTGGGG + Intronic
1020017127 7:4837626-4837648 GTGTGTGCATGTGTGTTTTTGGG - Intronic
1020427379 7:8084172-8084194 GAAATTGCATATGGGTTTTATGG + Intronic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1022529937 7:31060749-31060771 GAGAGTGAGTTTGTGTTTTGAGG - Intronic
1022845833 7:34209049-34209071 GTGATTCCCTGTGTGTTTGGTGG + Intergenic
1023072350 7:36448420-36448442 AAAAATGCATGTGTGTTGTGGGG - Intronic
1023305208 7:38818703-38818725 GTGATTTCATGGGTGGTTTGGGG - Intronic
1024274106 7:47663848-47663870 GAGCTTGGGGGTGTGTTTTGGGG - Intergenic
1024385057 7:48741633-48741655 GAAATTGTCTGGGTGTTTTGGGG + Intergenic
1026401014 7:70012940-70012962 GTGCATGTATGTGTGTTTTGGGG + Intronic
1028406156 7:90476525-90476547 GAAATAGAATGTGTATTTTGAGG + Intronic
1028493374 7:91438904-91438926 AAGAGTGCATGTGTGTGTTGTGG - Intergenic
1028881618 7:95886595-95886617 GAGATTGGCTGTCTGGTTTGAGG - Intronic
1029043614 7:97603659-97603681 GTGTGTGCATGTGTGTATTGTGG + Intergenic
1030263253 7:107588794-107588816 GAGTTTACATGTGGATTTTGGGG - Intronic
1030377619 7:108771498-108771520 GATAGTGCATCTGTGTTTAGTGG + Intergenic
1030561552 7:111093261-111093283 TAGATTGCATGTGGCATTTGAGG - Intronic
1033420701 7:141202397-141202419 GAAATTCCATGTGTGTAATGAGG + Intronic
1034365383 7:150541881-150541903 GAGATTGCAGGTGCATTTGGAGG - Intergenic
1034490003 7:151388036-151388058 GAGATTGCACCTGCGTTTTGGGG - Intronic
1034517452 7:151591834-151591856 GAGAAGGCATGGTTGTTTTGGGG - Intronic
1034612734 7:152386589-152386611 GGGATTGCATGGGAGGTTTGGGG - Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1036762581 8:11519917-11519939 GAGATTGCCTCTGGGTATTGGGG + Intronic
1037174197 8:15928131-15928153 GAAATGGCATGTTTGTATTGGGG - Intergenic
1038061535 8:23919317-23919339 GAGAATGTATGTGTGTTTTGTGG + Intergenic
1038147228 8:24909576-24909598 GAAATTTCATGTGTGTGGTGGGG - Intergenic
1038347827 8:26748286-26748308 GAGAATGTGTGTGTGTGTTGGGG + Exonic
1038473634 8:27845946-27845968 GAGATTGCATTTGCATTTTATGG + Intergenic
1039398552 8:37247902-37247924 GAGATGCCGTGTGTGTTTTTGGG + Intergenic
1039597903 8:38807318-38807340 GATATTGTTTATGTGTTTTGAGG + Intronic
1040604995 8:48922799-48922821 AAGAGTGTATGTGTGTTTGGAGG + Intergenic
1040883088 8:52229700-52229722 GAGATTTCATGGATATTTTGGGG + Intronic
1041143156 8:54843924-54843946 AAGAGTGCAATTGTGTTTTGGGG - Intergenic
1041165618 8:55089724-55089746 GAGGGTGCATTGGTGTTTTGTGG - Intergenic
1041400588 8:57439646-57439668 GAGATTCTATGTGCTTTTTGAGG + Intergenic
1042461535 8:69074705-69074727 GAGACTGTGTGTGTGTGTTGGGG + Intergenic
1042559415 8:70061832-70061854 GAATTTGGGTGTGTGTTTTGGGG - Intronic
1043378269 8:79674317-79674339 GTGAGTGCATGTGTCTTTTTGGG + Intergenic
1044080943 8:87882953-87882975 GGGAGTGCCTGTGTGTGTTGAGG - Intergenic
1045588891 8:103570523-103570545 GAGATTGTAAATGTGTTTAGGGG + Intronic
1051088276 9:13377458-13377480 GAGATTTTATGAGTGTTTTATGG + Intergenic
1052491834 9:29179316-29179338 GAGAATGCAACTGTGTTTTTGGG - Intergenic
1053310339 9:37014327-37014349 GAGATTCCATGTATGAGTTGGGG + Intronic
1054842472 9:69758578-69758600 GAGGTGGCAGGTGTGTTTTGAGG + Intronic
1055205981 9:73731031-73731053 GAGCTTGCATGTGTCTATTTCGG - Intergenic
1055238210 9:74150037-74150059 GAGAATGCAGGTTTTTTTTGGGG + Intergenic
1056565698 9:87770941-87770963 ACCATTGCATGCGTGTTTTGGGG + Intergenic
1056902312 9:90611529-90611551 GAGAGAGCAAGTGTGCTTTGGGG + Exonic
1057014704 9:91641635-91641657 GAGAATCCATGTGAGTTCTGAGG - Intronic
1058417736 9:104805767-104805789 GAAAAAGCATGTGAGTTTTGAGG - Intronic
1060396575 9:123320796-123320818 GTGAGTGTGTGTGTGTTTTGGGG + Intergenic
1061815822 9:133195096-133195118 GAGATTCCATGTGAATTTTGGGG - Intergenic
1062124695 9:134853654-134853676 GAAAGTGCATGTGGCTTTTGTGG - Intergenic
1062616406 9:137398521-137398543 GCGGTTGCCTGTGTGTCTTGGGG - Intronic
1062616411 9:137398546-137398568 GCGGTTGCCTGTGTGTCTTGGGG - Intronic
1062616416 9:137398571-137398593 GCGGTTGCCTGTGTGTCTTGGGG - Intronic
1062616489 9:137398896-137398918 GCGGTTGCCTGTGTGTCTTGGGG - Intronic
1187148045 X:16655703-16655725 GATACTTCATGGGTGTTTTGCGG - Intronic
1187822527 X:23303279-23303301 TAGATAGTATGTGTGTTTTGGGG - Intergenic
1188235614 X:27727668-27727690 GTGTTTATATGTGTGTTTTGGGG - Intronic
1188928197 X:36071207-36071229 TAAATTGCATATGTATTTTGAGG + Intronic
1188980499 X:36722443-36722465 GATATTGCACATGTGTTCTGAGG + Intergenic
1188981550 X:36731417-36731439 GAAATTGCATGGGTGGTGTGTGG - Intergenic
1189292518 X:39896186-39896208 GAAATTTCATGTGTGGTTGGGGG + Intergenic
1191895447 X:65987694-65987716 GAGAATACCTGTGTGATTTGAGG - Intergenic
1194293428 X:92102511-92102533 GGGAAAGCATGTGTGTTTTTAGG + Intronic
1194689651 X:96967858-96967880 AAAAGTGCATGTGTCTTTTGGGG + Intronic
1195256118 X:103092892-103092914 GAGATTGGCTGGGTGTTATGTGG + Intronic
1195596473 X:106696923-106696945 GGGCTTGCTTATGTGTTTTGGGG + Intronic
1196852259 X:119948588-119948610 GAACTTGCAGGTGTGTTCTGAGG + Intergenic
1197388108 X:125826314-125826336 GTGTTTGCAACTGTGTTTTGTGG + Intergenic
1198176431 X:134160143-134160165 GAAATGGTATGTGTGTGTTGAGG + Intergenic
1199340760 X:146674765-146674787 GAGGTTTCATGTTTATTTTGGGG + Intergenic
1199682659 X:150238084-150238106 GAGAGTGTGTGTGTGTTTGGGGG - Intergenic
1200097942 X:153672832-153672854 GAGATGGCATGTGTGAGTGGTGG - Intronic