ID: 1107731735

View in Genome Browser
Species Human (GRCh38)
Location 13:43355866-43355888
Sequence TCCACAGGGATCCCCAGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107731735_1107731741 0 Left 1107731735 13:43355866-43355888 CCGTGTCTGGGGATCCCTGTGGA 0: 1
1: 0
2: 0
3: 21
4: 271
Right 1107731741 13:43355889-43355911 GGAAGAAAAGCCAGCGTGGGTGG 0: 1
1: 0
2: 2
3: 43
4: 394
1107731735_1107731739 -4 Left 1107731735 13:43355866-43355888 CCGTGTCTGGGGATCCCTGTGGA 0: 1
1: 0
2: 0
3: 21
4: 271
Right 1107731739 13:43355885-43355907 TGGAGGAAGAAAAGCCAGCGTGG 0: 1
1: 0
2: 1
3: 42
4: 399
1107731735_1107731740 -3 Left 1107731735 13:43355866-43355888 CCGTGTCTGGGGATCCCTGTGGA 0: 1
1: 0
2: 0
3: 21
4: 271
Right 1107731740 13:43355886-43355908 GGAGGAAGAAAAGCCAGCGTGGG 0: 1
1: 0
2: 3
3: 27
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107731735 Original CRISPR TCCACAGGGATCCCCAGACA CGG (reversed) Intronic
901320434 1:8336884-8336906 TCCACCGGGAAGCACAGACATGG - Intronic
902684662 1:18068132-18068154 TCTCCTGGGATCACCAGACAGGG + Intergenic
903230141 1:21916931-21916953 GCCACAGGGCTCCCCACCCATGG + Intronic
903887041 1:26546609-26546631 CCCAAAGGGATGCCCAGGCATGG - Intronic
906154214 1:43604688-43604710 TCCACAGTGAGCACCAAACAGGG - Intronic
907290896 1:53412322-53412344 CCCACAGGGACCCCCACAGAGGG - Intergenic
912273351 1:108231741-108231763 TCTTCAGGGATCCCCAGCCCTGG - Intronic
912294869 1:108462581-108462603 TCTTCAGGGATCCCCAGCCCTGG + Intronic
913605443 1:120461575-120461597 TCCACTTGGAAGCCCAGACAAGG + Intergenic
913642309 1:120824295-120824317 TCCACTTGGAAGCCCAGACAAGG + Intronic
913642488 1:120825835-120825857 TCCACTTGGAAGCCCAGACAAGG + Intronic
913642668 1:120827375-120827397 TCCACTTGGAAGCCCAGACAAGG + Intronic
913642784 1:120828422-120828444 TCCACTTGGAAGCCCAGACAAGG + Intronic
913643399 1:120833924-120833946 TCCACTTGGAAGCCCAGACAAGG + Intronic
914083097 1:144427647-144427669 TCCACTTGGAAGCCCAGACAAGG - Intronic
914178021 1:145296167-145296189 TCCACTTGGAAGCCCAGACAAGG - Intronic
914178566 1:145300929-145300951 TCCACTTGGAAGCCCAGACAAGG - Intronic
914179863 1:145312037-145312059 TCCACTTGGAAGCCCAGACAAGG - Intronic
914180409 1:145316807-145316829 TCCACTTGGAAGCCCAGACAAGG - Intronic
914180952 1:145321569-145321591 TCCACTTGGAAGCCCAGACAAGG - Intronic
914181495 1:145326319-145326341 TCCACTTGGAAGCCCAGACAAGG - Intronic
914182040 1:145331086-145331108 TCCACTTGGAAGCCCAGACAAGG - Intronic
914182585 1:145335842-145335864 TCCACTTGGAAGCCCAGACAAGG - Intronic
914183130 1:145340596-145340618 TCCACTTGGAAGCCCAGACAAGG - Intronic
914183675 1:145345350-145345372 TCCACTTGGAAGCCCAGACAAGG - Intronic
914184218 1:145350120-145350142 TCCACTTGGAAGCCCAGACAAGG - Intronic
914184762 1:145354884-145354906 TCCACTTGGAAGCCCAGACAAGG - Intronic
914185307 1:145359631-145359653 TCCACTTGGAAGCCCAGACAAGG - Intronic
914185852 1:145364385-145364407 TCCACTTGGAAGCCCAGACAAGG - Intronic
914186399 1:145369145-145369167 TCCACTTGGAAGCCCAGACAAGG - Intronic
914186943 1:145373893-145373915 TCCACTTGGAAGCCCAGACAAGG - Intronic
914187486 1:145378643-145378665 TCCACTTGGAAGCCCAGACAAGG - Intronic
914188031 1:145383399-145383421 TCCACTTGGAAGCCCAGACAAGG - Intronic
914188574 1:145388147-145388169 TCCACTTGGAAGCCCAGACAAGG - Intronic
914189116 1:145392903-145392925 TCCACTTGGAAGCCCAGACAAGG - Intronic
914210970 1:145578612-145578634 TCCACTTGGAAGCCCAGACAAGG - Intergenic
914269730 1:146069372-146069394 TCCACTTGGAAGCCCAGACAAGG - Intronic
914270271 1:146074100-146074122 TCCACTTGGAAGCCCAGACAAGG - Intronic
914270808 1:146078836-146078858 TCCACTTGGAAGCCCAGACAAGG - Intronic
914271345 1:146083566-146083588 TCCACTTGGAAGCCCAGACAAGG - Intronic
914271880 1:146088293-146088315 TCCACTTGGAAGCCCAGACAAGG - Intronic
914272417 1:146093011-146093033 TCCACTTGGAAGCCCAGACAAGG - Intronic
914272955 1:146097733-146097755 TCCACTTGGAAGCCCAGACAAGG - Intronic
914273493 1:146102455-146102477 TCCACTTGGAAGCCCAGACAAGG - Intronic
914274032 1:146107173-146107195 TCCACTTGGAAGCCCAGACAAGG - Intronic
914274569 1:146111883-146111905 TCCACTTGGAAGCCCAGACAAGG - Intronic
914275102 1:146116601-146116623 TCCACTTGGAAGCCCAGACAAGG - Intronic
914275639 1:146121327-146121349 TCCACTTGGAAGCCCAGACAAGG - Intronic
914276170 1:146126065-146126087 TCCACTTGGAAGCCCAGACAAGG - Intronic
914366651 1:146985134-146985156 TCCACTTGGAAGCCCAGACAAGG + Intronic
914367187 1:146989895-146989917 TCCACTTGGAAGCCCAGACAAGG + Intronic
914485795 1:148108311-148108333 TCCACTTGGAAGCCCAGACAAGG - Intronic
914532567 1:148536053-148536075 TCCACTTGGAAGCCCAGACAAGG - Intronic
914533103 1:148540779-148540801 TCCACTTGGAAGCCCAGACAAGG - Intronic
914533638 1:148545493-148545515 TCCACTTGGAAGCCCAGACAAGG - Intronic
914534174 1:148550201-148550223 TCCACTTGGAAGCCCAGACAAGG - Intronic
914534710 1:148554909-148554931 TCCACTTGGAAGCCCAGACAAGG - Intronic
914535246 1:148559622-148559644 TCCACTTGGAAGCCCAGACAAGG - Intronic
914535782 1:148564368-148564390 TCCACTTGGAAGCCCAGACAAGG - Intronic
914536317 1:148569084-148569106 TCCACTTGGAAGCCCAGACAAGG - Intronic
914537214 1:148577012-148577034 TCCACTTGGAAGCCCAGACAAGG - Intronic
914586129 1:149063462-149063484 TCCACTTGGAAGCCCAGACAAGG - Intronic
918083382 1:181224459-181224481 TCGTTAGGGATCCCAAGACAAGG + Intergenic
920311573 1:205051917-205051939 TCCACACGGGTCCCCATCCAGGG + Intronic
920855879 1:209661200-209661222 ACCACAGGGATTCCTAAACAAGG - Intergenic
923508106 1:234624196-234624218 TCCACTGAGGTCCCCAGAAAGGG - Intergenic
924039532 1:239970981-239971003 TCCAATGGGCTCCCCAGAGAAGG + Intergenic
924945873 1:248846708-248846730 TCCTAATGCATCCCCAGACAAGG + Intronic
1067755637 10:49002143-49002165 TTCACAGTGATCCCCACGCACGG - Intergenic
1070574287 10:77665740-77665762 TCCACAGGGATTTCCAGGGAGGG - Intergenic
1070681662 10:78453236-78453258 TCCTCAGGGAAACCCAGACATGG + Intergenic
1070959892 10:80491324-80491346 GCCAGAGGGCTCTCCAGACAGGG - Intronic
1071261385 10:83922601-83922623 TCCAAAGGAGTCCCCAGAGAAGG + Intergenic
1072542051 10:96406049-96406071 ACCTCAGGGATGTCCAGACAGGG - Intronic
1072619085 10:97067951-97067973 TCACCAGGGAAACCCAGACAGGG - Intronic
1076121016 10:127936546-127936568 TCCACAGGGGTCTTCAGATAGGG + Intronic
1076696436 10:132249534-132249556 TCCACAGGGATCCCTGCTCAAGG + Intronic
1077473225 11:2774567-2774589 ACCCCAGGAATCCCAAGACAGGG - Intronic
1079658913 11:23016867-23016889 GCCACAGGTATCCCTAGACCTGG - Intergenic
1081636678 11:44726748-44726770 GGCCCAGGGACCCCCAGACAAGG + Intronic
1082816621 11:57514000-57514022 TCAACAGGGAGCCCCAGCCCAGG + Exonic
1083889509 11:65588919-65588941 TCCTCAGGGCTCCCCAGACCTGG - Intronic
1084679696 11:70659716-70659738 TCCACAAGCACCCCCAGACTGGG + Intronic
1088914598 11:114217915-114217937 TCTGCAGGGATCCCCACACCAGG - Intronic
1088988364 11:114929401-114929423 TCTTCAGGGATGCCCAGAGAGGG - Intergenic
1091453262 12:586812-586834 TGCAGAGGGATCCCCACACCTGG - Intronic
1095892695 12:47249658-47249680 ACCACAGGGATCCACTGAGAGGG + Intergenic
1096231318 12:49898341-49898363 TCCCCAGGGAGCCCCAGCCGGGG - Intronic
1097042105 12:56161908-56161930 TCCACAGGCTTCCCCACAAAAGG - Intronic
1097360908 12:58656681-58656703 TGCACAGGGATGCCCAGATCTGG + Intronic
1102914155 12:116740367-116740389 TCCAGAGGGATGCACAGTCAGGG - Exonic
1104197494 12:126554867-126554889 TCCAAAGGGATCCGCTGACAAGG - Intergenic
1105700874 13:22935139-22935161 TCCCTGGGGATCCCCAGACCAGG - Intergenic
1105853696 13:24358196-24358218 TCCCTGGGGATCCCCAGACCAGG - Intergenic
1106132373 13:26951061-26951083 TCCGCAGGCCTCCCCAGTCAGGG - Intergenic
1107731735 13:43355866-43355888 TCCACAGGGATCCCCAGACACGG - Intronic
1107884713 13:44865813-44865835 ACCACAGGGAGCCCAAGACTGGG + Intergenic
1108847875 13:54697678-54697700 TCCACAGGTACCTCCAGCCAGGG - Intergenic
1112339457 13:98540938-98540960 TCCCCAGGCCTCCACAGACAAGG + Intronic
1113093364 13:106637595-106637617 TCCACAGGGATCCCCAAGAAAGG - Intergenic
1113635370 13:111915489-111915511 TGCACCTGGATTCCCAGACAGGG - Intergenic
1113666946 13:112147888-112147910 TCCACAGGGACCATCACACAGGG - Intergenic
1114407822 14:22473012-22473034 TCAAGAGGGGTCCTCAGACAAGG + Intergenic
1117782581 14:59249291-59249313 TACACAGGGCTCCCAGGACAAGG - Intronic
1118315742 14:64725123-64725145 TACAGTGGGATCCCCAGAGAGGG + Intronic
1119224720 14:72936212-72936234 TCCATAGGGAAACCCACACATGG + Intronic
1120141982 14:80939752-80939774 GCCCCAGGGATGCCCAGGCATGG - Intronic
1120254793 14:82105540-82105562 TGCACAGGGACCCCCATCCAGGG - Intergenic
1120788321 14:88556744-88556766 TCCACAGTGATCTCCACACTTGG + Intergenic
1120869523 14:89324674-89324696 ACCACAGGGACCCACACACATGG + Intronic
1122864802 14:104598817-104598839 ACCCCAGGGAGTCCCAGACAAGG + Intronic
1122900717 14:104781302-104781324 GCCACACTGAGCCCCAGACAGGG + Intronic
1123939841 15:25211510-25211532 TCCACATGGATCCCATCACATGG + Intergenic
1125922690 15:43534942-43534964 TCCACAGAGACCCCCTGGCATGG + Exonic
1127907327 15:63385554-63385576 TCTCCAGAGATCCCCAGAGATGG + Intergenic
1128984333 15:72208194-72208216 TCCACATGGCTCCCCAGGAAGGG + Intronic
1129689259 15:77704120-77704142 TCCACAGGGTGCCTCACACATGG + Intronic
1130148686 15:81294522-81294544 TCCTCAGGGAAGCCCAGGCAAGG + Intronic
1131869063 15:96742992-96743014 AGCACAGGGATCCCGAGACATGG + Intergenic
1132338034 15:101061255-101061277 TCCACAGGGATCTCTGGACCTGG - Exonic
1133155232 16:3869765-3869787 AACACAGGCATCCCCAAACAAGG + Intronic
1138354135 16:56364173-56364195 CCTACAGGGCACCCCAGACACGG + Intronic
1138460373 16:57144206-57144228 GCAACAGGTATCCCCAGCCAAGG + Intronic
1142476790 17:193635-193657 TCCACAGTGGTCCCCTGGCATGG + Intergenic
1143001156 17:3796065-3796087 TACACAGGGATGCACAAACACGG - Intronic
1146475406 17:33158483-33158505 TTCACAGCGATCCACAGACCAGG - Intronic
1146910264 17:36644048-36644070 GCCACAGGGATACCCCAACAGGG - Intergenic
1147184144 17:38704812-38704834 TCCAAAAAGACCCCCAGACACGG + Intergenic
1147649575 17:42054236-42054258 TCCACAGGGACCTCCAGGGAAGG + Intronic
1148071276 17:44910318-44910340 TGCTCAGGGATCTGCAGACAGGG + Intronic
1152259625 17:79260044-79260066 TCCAGAGGGCTCCCCACACCAGG - Intronic
1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG + Exonic
1152708812 17:81860161-81860183 CCCCCAGGGAGCCCCTGACATGG + Intronic
1153620755 18:6975325-6975347 TCCACAGGGAGCACCAGGGAAGG + Intronic
1157241122 18:46010298-46010320 TCCAAAGGGACCCCCGGGCAGGG + Intronic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161273912 19:3404885-3404907 TCCCCAGGGGTCCCCAGAGGCGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1161949946 19:7462383-7462405 TCCTCAGGGAACCCCAGGCCAGG + Intronic
1162131580 19:8529347-8529369 TCCACAGGTACACCCAGACTTGG - Intronic
1163838957 19:19593971-19593993 TCCTCAGCGACCCCTAGACATGG + Intronic
1164229278 19:23273858-23273880 TGCCCAGGGAGCTCCAGACACGG + Intergenic
1164447843 19:28332920-28332942 TGCACAGGGATGCCCAGAAGTGG - Intergenic
1164596598 19:29534284-29534306 GCCAAAGGGAGGCCCAGACAGGG - Intronic
1165458897 19:35932577-35932599 TGCACAGGGATCTCCATCCAGGG + Intergenic
1165578166 19:36838999-36839021 TTCTCATGGATTCCCAGACAGGG - Intronic
1167840593 19:52114730-52114752 TCCACAGGGATTTCAAGAGAAGG + Exonic
926801545 2:16664825-16664847 TCCCCAGGGAACCCAAGACAGGG - Intronic
928279048 2:29928142-29928164 TCCCCAGGGATCCACAGTCCAGG + Intergenic
932429297 2:71664396-71664418 TCCACAGCGAGCCCCAAACTTGG - Exonic
937772320 2:125734338-125734360 TCCAAAGGGATGCACTGACAGGG - Intergenic
937869718 2:126778383-126778405 TCAGCAGGGATCCCCAGGAAGGG - Intergenic
937906555 2:127055468-127055490 TGCCCTGGGTTCCCCAGACAGGG - Intronic
942093150 2:172513549-172513571 TTCACAGCGATCCCCACACAGGG - Intergenic
942248006 2:174025170-174025192 TTCACAGGGATCTCCAGGGAAGG + Intergenic
942978077 2:182043505-182043527 TCCACATATATGCCCAGACATGG + Intronic
944335052 2:198522877-198522899 TGCACAGTAATCCCCAAACAAGG + Intronic
945497645 2:210528614-210528636 ACCACTGAGATCCCCAGACTTGG - Intronic
946372042 2:219286751-219286773 GCCACTGGGCTCCCCAGGCAGGG - Exonic
946884177 2:224206585-224206607 TCCAGAGGAGGCCCCAGACATGG - Intergenic
947611397 2:231527037-231527059 TTCCCAGGGAACCGCAGACATGG + Intronic
947684754 2:232073098-232073120 TCCACAGGGAGCTCTTGACAAGG - Intronic
947782891 2:232785614-232785636 TCCACAGAGATCAGCAGTCAGGG + Intronic
949042008 2:241853825-241853847 GCCACAGGGTTCCCCAAACATGG + Intronic
1169066664 20:2697844-2697866 TCCAGAGGTCTCCCCAGACTGGG - Intronic
1170963128 20:21043154-21043176 TCCAGAGGCCTCCCCAGCCATGG + Intergenic
1171151258 20:22828173-22828195 TCAAAAGGGTTTCCCAGACAAGG - Intergenic
1175408774 20:58752471-58752493 CCCACAGGGATACCCAGGCCTGG + Intergenic
1175870721 20:62208290-62208312 TCACCTGGGATCCCCAGCCAAGG + Intergenic
1178231037 21:30785095-30785117 TCCACATGGATCCCAAGATGAGG + Intergenic
1179942843 21:44650840-44650862 GCCACAGAGATCCCCAGAGGTGG + Intronic
1180223645 21:46376054-46376076 TCCACAGAGAACCCCAGCCAGGG - Intronic
1180825180 22:18856670-18856692 TCCCCAGGGAGCCCAAGGCAGGG + Intronic
1181187550 22:21117877-21117899 TCCCCAGGGAGCCCAAGGCAGGG - Intergenic
1181211648 22:21292616-21292638 TCCCCAGGGAGCCCAAGGCAGGG + Intergenic
1181397859 22:22634270-22634292 TCCCCAGGGAGCCCAAGGCAGGG - Intergenic
1181403513 22:22666096-22666118 TCTGCAGGGATTCCAAGACAGGG + Intergenic
1181651548 22:24261788-24261810 TCCCCAGGGAGCCCAAGGCAGGG + Intergenic
1181705827 22:24648951-24648973 TCCCCAGGGAGCCCAAGGCAGGG - Intergenic
1182634142 22:31710984-31711006 TACACAGGTATCACCAGATATGG - Intronic
1183357587 22:37367861-37367883 CCCACTGGGAGCCCCAGTCATGG - Intergenic
1183385244 22:37510417-37510439 TCCACCTGGAGCCCAAGACATGG + Exonic
1184573187 22:45340013-45340035 TCCTCTGGGATCCCCAGGCTTGG - Intronic
1184837833 22:47034524-47034546 ACCTCAGGGATTCCCAAACAGGG - Intronic
1185109236 22:48891634-48891656 TCCTCAGAGATCCCAAGAAATGG - Intergenic
1185319246 22:50192977-50192999 TCCACCTGGAGCCCCAGACCTGG - Intronic
1203215305 22_KI270731v1_random:2816-2838 TCCCCAGGGAGCCCAAGGCAGGG - Intergenic
1203275325 22_KI270734v1_random:82573-82595 TCCCCAGGGAGCCCAAGGCAGGG + Intergenic
949814165 3:8040661-8040683 ACCACAGGGATCCACCGAGAGGG + Intergenic
951040567 3:17984518-17984540 TCCACAGGGGTCCAGAGACTGGG + Intronic
951990415 3:28670502-28670524 TCCACAGGCATCCCATGAAAAGG - Intergenic
952205740 3:31180659-31180681 TGCACAGGGATCCCCACCCAGGG - Intergenic
952233805 3:31458423-31458445 TCTACAGGGTTAGCCAGACATGG + Intergenic
953596292 3:44318052-44318074 TGCACAGGGATTCCCACCCAGGG - Intronic
955653626 3:61221235-61221257 TGCACAGGGATGCCCTAACATGG + Intronic
957892424 3:86377466-86377488 TCGACAAGGATCCCAAGAGATGG - Intergenic
958582383 3:96044097-96044119 TCCTGAGGCCTCCCCAGACATGG - Intergenic
961214086 3:125146523-125146545 TCCCCAGGGATCCTCAGAGATGG + Intronic
961756739 3:129132155-129132177 GCCACATGGATCTCCACACATGG + Intronic
968519958 4:1030750-1030772 CCCACAGGGAGCCCCAGCCTTGG - Intergenic
968764615 4:2461823-2461845 TCCACAGGTACCTGCAGACATGG - Intronic
968880730 4:3297798-3297820 TGCACAGGGAGCCCCACAGATGG - Intronic
969087273 4:4665839-4665861 GACACAGACATCCCCAGACATGG + Intergenic
969280652 4:6168598-6168620 TCCATAGGGATGGCCAGGCACGG + Intronic
970990629 4:22209364-22209386 TCCCCAGGGATCACCACCCATGG - Intergenic
974831882 4:67199894-67199916 TCCAGAGGGATCCCCAGATGCGG + Intergenic
977551722 4:98449973-98449995 TCCATAGAAATCCCCAGATATGG + Intergenic
980169079 4:129264990-129265012 TCCTCAGAGATTCCAAGACATGG - Intergenic
980608630 4:135126538-135126560 ACCACAGGCATCCCCATACCCGG - Intergenic
981870517 4:149479832-149479854 TGCATAGGGAGCCCAAGACAGGG + Intergenic
983294401 4:165847727-165847749 ACCACAGGGATGCCTAGCCATGG + Intergenic
985638621 5:1052728-1052750 CCGACAGGGAACCCCAGCCACGG + Intronic
985883502 5:2658153-2658175 TCCACAGTGCAGCCCAGACAAGG - Intergenic
986291274 5:6400940-6400962 TTCACAGGGCTCCTCAGAGAAGG - Intergenic
987049703 5:14139223-14139245 TCCACACCATTCCCCAGACATGG + Intergenic
990488343 5:56280442-56280464 TCCGCAGGGATCCACAGCCATGG - Intergenic
992774455 5:80077383-80077405 TCCACTGGGAGTCCCAGAAAAGG + Intronic
993307221 5:86288340-86288362 TCTTCAGGGATCCCCAGCCCTGG + Intergenic
996884278 5:128337736-128337758 TCCACAGGGCTCCTCACACAGGG + Intronic
997148000 5:131458399-131458421 TCCTAAGGCCTCCCCAGACATGG + Intronic
999508072 5:152219012-152219034 TTCAGAAGGATCCCCAGAGAAGG - Intergenic
1001281097 5:170387010-170387032 GCCACAGAGATGCCCAGCCATGG + Intronic
1001867836 5:175120881-175120903 TGCACAGAGATGCACAGACAGGG - Intergenic
1002149602 5:177216813-177216835 TCCACAGAGATCCCTGGCCAGGG - Intronic
1002571188 5:180140210-180140232 CCCACAGGGATGCCCAGAGAGGG + Intronic
1006791096 6:36701811-36701833 TGCACAAGGATGCCCAGCCAAGG + Intronic
1007105838 6:39282355-39282377 TCCACAGGAATCACCAGGAAAGG - Intergenic
1007223179 6:40294804-40294826 TCCTCAGGGTTCCCCAGTAACGG + Intergenic
1008284684 6:49633901-49633923 TCCACAGGGAAAGGCAGACAAGG - Intronic
1010217803 6:73420271-73420293 TCCACAGGAATACCAAGACTAGG - Intronic
1010889486 6:81288524-81288546 TCCACTGGGATCCCCATCCCTGG + Intergenic
1013512965 6:110860227-110860249 TGCACAGGGACCCCCACCCAGGG + Intronic
1017663011 6:156692010-156692032 TCCAAAGGGGCCCACAGACAAGG + Intergenic
1018297562 6:162365593-162365615 TCCACAGAGATGCAGAGACAAGG - Intronic
1019903389 7:4042175-4042197 TACACAGGGACCCAGAGACAGGG - Intronic
1021342380 7:19480464-19480486 ACCACAGAGAGCCCCTGACAGGG + Intergenic
1022410189 7:30134488-30134510 TCCACTGCTAGCCCCAGACAAGG + Intergenic
1024221192 7:47288586-47288608 TTCACTGGGACCCACAGACAGGG + Intronic
1026087624 7:67275510-67275532 TCCACAGAGAACCGCAGAGACGG + Intergenic
1026431712 7:70354145-70354167 TCCACAAGGAAAGCCAGACAGGG - Intronic
1026726608 7:72874721-72874743 TCCACAGAGAACCGCAGAGACGG - Intergenic
1027117232 7:75490889-75490911 TCCACAGAGAACCGCAGAGACGG + Intergenic
1027274577 7:76544713-76544735 TCCACAGAGAACCGCAGAGACGG - Intergenic
1028454299 7:91021720-91021742 CCCAAAGGGATCCCTTGACAAGG - Intronic
1032192673 7:129773571-129773593 TCCCCAGGGAGCCTCAGGCAAGG - Intergenic
1032403457 7:131639444-131639466 CCTTCAGGGATCCCCAGAGAGGG - Intergenic
1035704733 8:1666933-1666955 TCCCCAAGGATGTCCAGACACGG - Intronic
1036600779 8:10258554-10258576 TCCAGTGGGATCCTCAGACACGG - Intronic
1038581249 8:28751066-28751088 TCCCCGGGGTTCCCCACACAGGG + Exonic
1038982897 8:32778629-32778651 TCCTGAGGCCTCCCCAGACATGG + Intergenic
1039745533 8:40422811-40422833 ACCACAGGGAGCCCCAGGCAGGG + Intergenic
1041653967 8:60330307-60330329 TCCACTGGGACCCCCAGTAAAGG - Intergenic
1042438054 8:68791183-68791205 TCCTGAGGCCTCCCCAGACATGG - Intronic
1042693200 8:71526836-71526858 TCCAAAGGGACCCCCTTACAAGG + Intronic
1045043368 8:98248896-98248918 TGCACAGGGATGCCCAGGCCTGG - Intronic
1045146290 8:99347945-99347967 TCCACTGTGATCACCAGACAAGG - Intronic
1049365445 8:142234755-142234777 TCCACAGTGCACCCCAGACATGG + Intronic
1049468755 8:142765606-142765628 TCCACAGGGAGCCCAGGGCAAGG + Intronic
1049596110 8:143484087-143484109 TCCTCAGGGGCCCCCAAACAAGG - Intronic
1049823048 8:144647774-144647796 TCCACGGGGACCCCAAGAGAGGG + Intergenic
1052436773 9:28439686-28439708 TCCTGAGGGCTCCCCAGGCATGG + Intronic
1052881292 9:33602314-33602336 GCCACAGGGGTCCCCAGGGAGGG - Intergenic
1053495026 9:38543528-38543550 GCCACAGGGGTCCCCAGGGAGGG + Intronic
1056804434 9:89717864-89717886 TCAACAGGGTTCAGCAGACATGG - Intergenic
1058136918 9:101317417-101317439 TCCACGGGGATCCTCAGGCTTGG - Exonic
1060161424 9:121369126-121369148 AACACAGGGATCCCTGGACAAGG + Intronic
1060282754 9:122225380-122225402 CCCACTGGGATCAGCAGACAAGG + Intronic
1060322698 9:122579392-122579414 TCCAAAGCAATCTCCAGACAAGG - Intergenic
1061144670 9:128790728-128790750 TCCACAGGCATCCCCTGTGAGGG + Exonic
1061486368 9:130922502-130922524 TCCACAGGCTGCCCCAGGCATGG - Intronic
1061669352 9:132179964-132179986 TTCACAGGGATCCACACACCTGG - Intronic
1061720455 9:132547847-132547869 TCCTCAGGGCTCTCCAGGCAGGG + Intronic
1061878471 9:133556673-133556695 TGCCCAGGTGTCCCCAGACATGG - Intronic
1062080638 9:134621594-134621616 TACAAAAGCATCCCCAGACATGG - Intergenic
1062570770 9:137184167-137184189 GGCACAGGGAGCCCCAGACGTGG + Intronic
1186336927 X:8599399-8599421 TCCACAGTGATCCCTAACCAGGG + Intronic
1186791035 X:12998959-12998981 TATACAGGGATCCTCAGGCAAGG - Intergenic
1187076992 X:15945251-15945273 TCCCCAGGGATCACCAGTGACGG - Intergenic
1188500292 X:30818310-30818332 TCCTGAGGCATCCCCAGAAACGG + Intergenic
1189356555 X:40314059-40314081 CCCACAGGGATCCCCGGTCAAGG - Intergenic
1190690002 X:52906020-52906042 ACCACAGGGATACCAAGAAAAGG - Intronic
1190695981 X:52949772-52949794 ACCACAGGGATACCAAGAAAAGG + Intronic
1193108455 X:77704401-77704423 TCCACAGGCAGGCCCAGAAAAGG + Intronic
1194448909 X:94017852-94017874 TCCCAAGGCCTCCCCAGACATGG + Intergenic
1200968050 Y:9119369-9119391 TTCACAGTGTTCCTCAGACAAGG + Intergenic
1201426407 Y:13856397-13856419 TCCACAGTGATCCCTAACCAGGG - Intergenic
1202142696 Y:21744719-21744741 TTCACAGTGTTCCTCAGACAAGG - Intergenic
1202144162 Y:21760899-21760921 TTCACAGTGTTCCTCAGACAAGG + Intergenic