ID: 1107731873

View in Genome Browser
Species Human (GRCh38)
Location 13:43356897-43356919
Sequence GCTCTTGCACGGGGCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107731873_1107731882 19 Left 1107731873 13:43356897-43356919 CCACAGCAGCCCCGTGCAAGAGC 0: 1
1: 0
2: 2
3: 15
4: 226
Right 1107731882 13:43356939-43356961 AAAATGGGCCTGGAAATCTTTGG 0: 1
1: 0
2: 1
3: 17
4: 183
1107731873_1107731884 21 Left 1107731873 13:43356897-43356919 CCACAGCAGCCCCGTGCAAGAGC 0: 1
1: 0
2: 2
3: 15
4: 226
Right 1107731884 13:43356941-43356963 AATGGGCCTGGAAATCTTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 183
1107731873_1107731879 3 Left 1107731873 13:43356897-43356919 CCACAGCAGCCCCGTGCAAGAGC 0: 1
1: 0
2: 2
3: 15
4: 226
Right 1107731879 13:43356923-43356945 GAGCTAGACAAAGAAAAAAATGG 0: 1
1: 1
2: 16
3: 171
4: 1788
1107731873_1107731880 4 Left 1107731873 13:43356897-43356919 CCACAGCAGCCCCGTGCAAGAGC 0: 1
1: 0
2: 2
3: 15
4: 226
Right 1107731880 13:43356924-43356946 AGCTAGACAAAGAAAAAAATGGG 0: 1
1: 0
2: 12
3: 149
4: 1208
1107731873_1107731883 20 Left 1107731873 13:43356897-43356919 CCACAGCAGCCCCGTGCAAGAGC 0: 1
1: 0
2: 2
3: 15
4: 226
Right 1107731883 13:43356940-43356962 AAATGGGCCTGGAAATCTTTGGG 0: 1
1: 0
2: 0
3: 19
4: 211
1107731873_1107731885 22 Left 1107731873 13:43356897-43356919 CCACAGCAGCCCCGTGCAAGAGC 0: 1
1: 0
2: 2
3: 15
4: 226
Right 1107731885 13:43356942-43356964 ATGGGCCTGGAAATCTTTGGGGG 0: 1
1: 0
2: 1
3: 20
4: 229
1107731873_1107731881 9 Left 1107731873 13:43356897-43356919 CCACAGCAGCCCCGTGCAAGAGC 0: 1
1: 0
2: 2
3: 15
4: 226
Right 1107731881 13:43356929-43356951 GACAAAGAAAAAAATGGGCCTGG 0: 1
1: 0
2: 24
3: 329
4: 4457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107731873 Original CRISPR GCTCTTGCACGGGGCTGCTG TGG (reversed) Intronic
901814583 1:11787040-11787062 GCTCTCCAAAGGGGCTGCTGGGG - Exonic
901977223 1:13004747-13004769 TCTCTTCCACTGGGCTCCTGTGG + Intronic
902004863 1:13224187-13224209 TCTCTTCCACTGGGCTCCTGTGG - Intergenic
902024081 1:13369922-13369944 TCTCTTCCACTGGGCTCCTGTGG - Intronic
902119631 1:14151807-14151829 GCTCTTCCACTGCTCTGCTGGGG - Intergenic
902135002 1:14297548-14297570 GATCTTGCAGGGGGCAGGTGTGG - Intergenic
902867010 1:19286217-19286239 TCTCTTCCACCGGGGTGCTGTGG + Exonic
903360160 1:22772072-22772094 GGTCTGGGACGGGGTTGCTGGGG - Intronic
903835862 1:26202853-26202875 GCTCTTGCCCAGAGCTGGTGGGG + Exonic
906113744 1:43341654-43341676 GCTCCAGCACAGGGCTTCTGTGG + Intronic
906249987 1:44303645-44303667 GCTCATGCATGTGGCTGGTGGGG + Intronic
906552051 1:46673241-46673263 GATCTGGCCTGGGGCTGCTGTGG - Exonic
911504120 1:98727265-98727287 TCTCTTCTACAGGGCTGCTGTGG - Intronic
912827963 1:112923696-112923718 TCTCTTCCACCGGGGTGCTGTGG - Intronic
917194466 1:172450720-172450742 CCTCAGGCACGGGGCTGCTCCGG - Intronic
917352162 1:174089747-174089769 ACTCTTCCACAGGGCTGCTGCGG + Intergenic
920308391 1:205033184-205033206 GCTTTAGCACGGGGCTCCTTCGG + Intergenic
921176026 1:212595364-212595386 GCTGTAGCCTGGGGCTGCTGAGG - Intronic
922565083 1:226596565-226596587 GGTATTGCACGGGGCTGCCAGGG - Intronic
924652323 1:245940528-245940550 CCTCTTCCATAGGGCTGCTGTGG - Intronic
1066370553 10:34815304-34815326 GCGCTCGCTCGGGGCCGCTGGGG + Exonic
1070442783 10:76463164-76463186 GCTCTTCCACGGGACTGCCTTGG - Intronic
1072554865 10:96507070-96507092 CCTCTTGGAGGGGGCTGCTCTGG - Intronic
1072766120 10:98096505-98096527 CCTCCTGCCCGGGGCTCCTGGGG + Intergenic
1074769385 10:116723550-116723572 TCTCTCTCACAGGGCTGCTGTGG + Intronic
1075739041 10:124682177-124682199 GCGCTTGCTAGGGGGTGCTGAGG + Exonic
1076340905 10:129744257-129744279 GGCATTGGACGGGGCTGCTGTGG + Intronic
1076831526 10:132996713-132996735 GCTTCTGCTCCGGGCTGCTGTGG + Intergenic
1077059165 11:610213-610235 GCTCCTTCTCGGGGCTTCTGTGG - Exonic
1077166009 11:1139234-1139256 GGCCTTGCACGGGGTGGCTGGGG + Intergenic
1077220460 11:1413323-1413345 GCCCCTGCAAGGGGCTGCAGGGG - Intronic
1077531013 11:3094740-3094762 GCTCTGGCATTGGGCTCCTGAGG + Intronic
1080513673 11:33000695-33000717 ACTCTTCCATAGGGCTGCTGTGG + Intergenic
1080648847 11:34207003-34207025 GCCCTGGCAGGGGGCTGCGGGGG - Intronic
1082997066 11:59263086-59263108 GCCCTGCCAGGGGGCTGCTGTGG + Intergenic
1083276814 11:61601565-61601587 GCTCTGACACGGGGATTCTGTGG + Intergenic
1083713011 11:64560220-64560242 GCTCAGGCAAGGGGATGCTGTGG - Intronic
1084412472 11:69012741-69012763 GCTCCTGCTCTGTGCTGCTGGGG - Intronic
1086741830 11:90379078-90379100 ATTCTTCCATGGGGCTGCTGTGG + Intergenic
1087374739 11:97326697-97326719 GCTTTTGCATAGGGCTGCTGTGG + Intergenic
1088588335 11:111379408-111379430 GCTCTGGGCCGGGGCCGCTGGGG - Exonic
1088822045 11:113464699-113464721 GCACTTGAACTGGGCTGCAGAGG - Intronic
1090075221 11:123576330-123576352 AAGCCTGCACGGGGCTGCTGGGG - Intronic
1091395817 12:153720-153742 GCTTTTGCATGGGGGTGGTGAGG - Intronic
1091601834 12:1922503-1922525 GCCCTCCCACGGGACTGCTGTGG - Intergenic
1094834464 12:34315824-34315846 GCCCTGCGACGGGGCTGCTGAGG + Intergenic
1100156498 12:91805356-91805378 GCTCTTCCATGGGGCTGCTGTGG - Intergenic
1101001827 12:100364529-100364551 GCTCTAGCACTGGGTGGCTGAGG + Intronic
1101876152 12:108598052-108598074 GCTGGTGCCCGGGGCTGCTCTGG + Exonic
1102762551 12:115400957-115400979 GCTCCTGTAGGGGGCTGCTCAGG + Intergenic
1103357355 12:120331590-120331612 TCTGTTGGACAGGGCTGCTGTGG + Intergenic
1104475753 12:129069124-129069146 GCCCTGGCACTGGGCTGGTGGGG - Intergenic
1104597248 12:130128267-130128289 GCTCTTCCAGGGGCCAGCTGGGG - Intergenic
1104612935 12:130244245-130244267 GCTCTTGCACTCAACTGCTGAGG - Intergenic
1104990635 12:132622092-132622114 GCCCTTGCACAGGGATCCTGTGG - Intronic
1105245591 13:18647081-18647103 GCTGTTGCATGGGATTGCTGAGG - Intergenic
1105473400 13:20711648-20711670 GTACCTGCACTGGGCTGCTGGGG - Intronic
1106472117 13:30065378-30065400 GGCCCTGCACTGGGCTGCTGTGG + Intergenic
1107064230 13:36195402-36195424 GCTCTGGCACAGGGCATCTGAGG + Intronic
1107731873 13:43356897-43356919 GCTCTTGCACGGGGCTGCTGTGG - Intronic
1113661497 13:112109152-112109174 GCTCCTGCCTGAGGCTGCTGAGG + Intergenic
1115385309 14:32789622-32789644 ACTCTAGCATAGGGCTGCTGCGG - Intronic
1117803093 14:59464917-59464939 GCTGTCGCACGGAGCTGCAGTGG - Exonic
1119645307 14:76343642-76343664 GCCCCTCCACGGGGCTGCTTGGG + Intronic
1120057790 14:79946018-79946040 TCTCTGGGATGGGGCTGCTGGGG - Intergenic
1121323228 14:93004927-93004949 GCACATTCACGGGCCTGCTGGGG + Intronic
1121797324 14:96745941-96745963 GCTCTTGGACTGGGATCCTGTGG + Intergenic
1122776420 14:104118835-104118857 CCCCTCTCACGGGGCTGCTGAGG - Intergenic
1122875219 14:104660755-104660777 GCTCCTGCCTGGGGATGCTGGGG + Intergenic
1122919722 14:104875023-104875045 GCCCTTGCCCAGGGGTGCTGGGG + Intronic
1123062830 14:105601969-105601991 GCACTTGCAGGGGGAGGCTGGGG - Intergenic
1124636027 15:31365789-31365811 GCATTTGCATGTGGCTGCTGTGG + Intronic
1125054479 15:35341610-35341632 ACTCTTCCACAGAGCTGCTGTGG + Intronic
1125932093 15:43607658-43607680 GCTCCAGCACAGGGCAGCTGAGG - Intronic
1125945192 15:43707132-43707154 GCTCCAGCACAGGGCAGCTGAGG - Intergenic
1126421491 15:48477975-48477997 GCTTGTGCCCGGGGCTGCTGTGG + Intronic
1126784310 15:52163976-52163998 TCTCCTCCACAGGGCTGCTGCGG - Intronic
1128074125 15:64815875-64815897 GCTCTTGGAGGGGACTGGTGGGG - Exonic
1129106239 15:73309265-73309287 GCCTTTGCACTGGCCTGCTGGGG - Intergenic
1129834807 15:78695481-78695503 GAGCTTGCAGGGGGCAGCTGAGG + Intronic
1130102271 15:80903096-80903118 GGTCTTGAACGTGGCTGCAGAGG - Intronic
1133401524 16:5490717-5490739 GCTCTCCCACGCGGCTGCTCTGG - Intergenic
1136626409 16:31464780-31464802 GCTATGGCGCGGCGCTGCTGCGG + Exonic
1138529399 16:57626954-57626976 GCTCTCTCCCGGGGCTGCAGTGG - Intronic
1139955868 16:70692726-70692748 GGCCTTGCCAGGGGCTGCTGAGG - Intronic
1140356350 16:74310186-74310208 CCTCTTGCACACTGCTGCTGGGG + Intergenic
1140647229 16:77045811-77045833 GGTCTTTCACAAGGCTGCTGAGG + Intergenic
1140890847 16:79283879-79283901 TCTCCTGCACGGGGTAGCTGGGG + Intergenic
1142194835 16:88734582-88734604 GCACTTCCCCGGGGCTGCAGCGG - Intronic
1144782136 17:17813668-17813690 GCTGGTGCCCTGGGCTGCTGGGG + Exonic
1144938619 17:18920099-18920121 GCCCTTGCAGGGTTCTGCTGAGG - Intronic
1148213815 17:45823873-45823895 GTTCTTCCACGGTGCTGCTCTGG + Intronic
1154223054 18:12474267-12474289 GCTCATGCAAGGGGCAGCAGAGG + Intronic
1154443353 18:14412849-14412871 GCTGTTGCATGGGATTGCTGAGG + Intergenic
1155184940 18:23379456-23379478 GCTCTTACACTAGGCTGTTGAGG - Intronic
1159235850 18:65671927-65671949 CCTCTTCCACAGGTCTGCTGTGG - Intergenic
1160243129 18:77137030-77137052 GCTCCTGCCAGGGGCTGCAGGGG - Intergenic
1160327730 18:77966477-77966499 GCTCTGGTCCAGGGCTGCTGAGG + Intergenic
1162038660 19:7956139-7956161 CCTCGTCCACAGGGCTGCTGTGG + Intergenic
1162793077 19:13072955-13072977 GCTCTTGCACCAGGCTGGAGGGG + Intronic
1163592605 19:18202972-18202994 CCCCTTGAAGGGGGCTGCTGGGG - Intronic
1166899166 19:46044867-46044889 ACTATTCCACAGGGCTGCTGTGG - Intronic
925049036 2:796759-796781 GCTCTGGAACCCGGCTGCTGGGG + Intergenic
925087010 2:1116428-1116450 GCTCTTGCATGGGGGTGCTCTGG + Intronic
925087065 2:1116668-1116690 GCTCTGGCATGGGGGTGCTCTGG + Intronic
925206844 2:2014353-2014375 GCTGGAGCACAGGGCTGCTGTGG - Intronic
925406889 2:3611696-3611718 GCTGTGGCACGGGGGTGATGTGG + Intronic
926233697 2:11023740-11023762 GGTCTTGCATGGGGGTTCTGCGG + Intergenic
926675883 2:15619298-15619320 GCTCTTGCCCGCCACTGCTGCGG - Intronic
929287284 2:40149712-40149734 GCTACTGCACGAGGCTGCTGTGG + Intronic
931746290 2:65294350-65294372 GCCCTTTCACAGGGCTGCCGGGG - Intergenic
933465243 2:82642577-82642599 ACTCTTCCACAGGACTGCTGTGG - Intergenic
933621095 2:84542400-84542422 GGTATTGCACAGGGCTGGTGAGG - Intronic
934553087 2:95274193-95274215 GCTCCTAGACTGGGCTGCTGGGG + Intergenic
935952547 2:108344614-108344636 GCTCTTCCATAGGGCTGCTGTGG + Intergenic
936605272 2:113945906-113945928 GTTCTTGCACTGGTTTGCTGAGG + Intronic
937357741 2:121208943-121208965 GCTCTTCCTCTGGGCTGCCGTGG - Intergenic
941136309 2:161722438-161722460 TCTCTTCCACAGGGCTGCTGTGG + Intronic
944439306 2:199726655-199726677 CCTCTTCCATAGGGCTGCTGTGG + Intergenic
946063726 2:216968256-216968278 GGTGCTGCAGGGGGCTGCTGAGG + Intergenic
948053611 2:234995763-234995785 GCTCTGTCCCGCGGCTGCTGGGG - Intronic
948450394 2:238066700-238066722 GCTTTTGCCCTGGGCTGCTGAGG + Intronic
948762340 2:240199739-240199761 TCTCCTGCCCGGGTCTGCTGGGG - Intergenic
949020932 2:241741033-241741055 GCTGTAGCAAGGTGCTGCTGAGG + Exonic
1168971680 20:1935552-1935574 GCTCATGTCCGGGGCTGCGGGGG - Intronic
1174181343 20:48676855-48676877 GCCCCTGCAAGGGGCTGGTGTGG + Intronic
1174204389 20:48828159-48828181 GCGCGTGCACGGGGCCCCTGGGG + Intergenic
1175626991 20:60497195-60497217 GCTCTTGCACCTGGCCGCTCGGG + Intergenic
1176349779 21:5783549-5783571 GCTCTTTCACGGGACTGGAGTGG + Intergenic
1176356593 21:5904133-5904155 GCTCTTTCACGGGACTGGAGTGG + Intergenic
1176428131 21:6561125-6561147 GCTCTACCACGTGGCTGCAGTGG - Intergenic
1176452738 21:6878359-6878381 GCTGTTGCATGGGATTGCTGAGG - Intergenic
1176523043 21:7838977-7838999 ACTCTTCCGCAGGGCTGCTGTGG - Intergenic
1176544100 21:8181619-8181641 GCTCTTTCACGGGACTGGAGTGG + Intergenic
1176563051 21:8364664-8364686 GCTCTTTCACGGGACTGGAGTGG + Intergenic
1176830911 21:13743408-13743430 GCTGTTGCATGGGATTGCTGAGG - Intergenic
1177916986 21:27101191-27101213 GCTCTTACACGGGGGTGCTATGG - Intergenic
1178657063 21:34468989-34469011 ACTCTTCCGCAGGGCTGCTGTGG - Intergenic
1179569738 21:42271401-42271423 GCTCATCCAGGGTGCTGCTGTGG - Intronic
1179703622 21:43169442-43169464 GCTCTGCCACGTGGCTGCAGTGG - Intronic
1181045980 22:20214441-20214463 TCCCTGTCACGGGGCTGCTGAGG + Intergenic
1181486839 22:23236906-23236928 GCTCTGGCAGGGGGTAGCTGTGG + Intronic
1181793047 22:25282785-25282807 GCGCTTGCAGGGCGCTGGTGGGG + Intergenic
1181813686 22:25421073-25421095 CCGCTTGCAGGGCGCTGCTGGGG + Intergenic
1182844268 22:33417684-33417706 GCTCTTGCCCGGGGCTCTCGGGG + Intronic
1184959061 22:47915614-47915636 GCTCATGCAGGGTGCAGCTGTGG + Intergenic
1185370068 22:50456793-50456815 CCTCTCGCACGGCCCTGCTGGGG - Intronic
1203248968 22_KI270733v1_random:97854-97876 GCTCTTTCACGGGACTGGAGTGG + Intergenic
949476093 3:4447040-4447062 GCACCTGGATGGGGCTGCTGGGG + Intronic
949935862 3:9115098-9115120 GTTCTTTCACGGGTCAGCTGTGG + Intronic
951469860 3:23044445-23044467 GCTTTTCCACGGGGCTGCTGTGG - Intergenic
952756599 3:36874382-36874404 CCTCTTGCCCTGGGCTGCTTGGG - Intronic
954159873 3:48713398-48713420 GCTCTGGCCCTGGGGTGCTGTGG - Intronic
956859370 3:73307339-73307361 CCTCTTTCACTGGGTTGCTGTGG - Intergenic
957690025 3:83555501-83555523 CCTCTTCCATAGGGCTGCTGAGG + Intergenic
959133784 3:102391569-102391591 GCTCCTCCACGGGGTTGCTTTGG - Intronic
961517609 3:127447902-127447924 GCTCTGGCAAGAGGCTGGTGTGG - Intergenic
961808437 3:129506310-129506332 GGGCTTGCACAGGGCTGCTTTGG - Intronic
963686391 3:148440079-148440101 GCCCTTGCTCTGGGCTGCTCTGG - Intergenic
966269851 3:178091251-178091273 ACTTTTCCACAGGGCTGCTGTGG - Intergenic
968794483 4:2693631-2693653 GCTATTCCTCGGGGCGGCTGGGG - Exonic
969286600 4:6206338-6206360 GATCTTCCACGGGGCTGGTGAGG - Intergenic
973543623 4:51958734-51958756 GTTGTTGCAGGGGGGTGCTGGGG + Intergenic
977037262 4:91970344-91970366 CCTCTTGCTCAGGGATGCTGGGG + Intergenic
977678692 4:99774796-99774818 TCTCTTCCATAGGGCTGCTGGGG - Intergenic
977879323 4:102186107-102186129 GCTCTTCCACGGTGATGCTGAGG + Intergenic
981273936 4:142875490-142875512 CCTCTTCCATAGGGCTGCTGTGG - Intergenic
985781337 5:1873489-1873511 GCTCCTGCTCAGGGCTGCTCTGG + Intergenic
985904643 5:2823729-2823751 GCCACTGCACGGGGCTGCTGTGG - Intergenic
986308770 5:6535882-6535904 GCTCTTGGCCGTGGCTGGTGAGG - Intergenic
986315672 5:6584852-6584874 GCAACTGCACGGGGCTGATGGGG - Intergenic
987088142 5:14488050-14488072 CCTTCTGCAGGGGGCTGCTGGGG - Exonic
988817561 5:34849915-34849937 GCAATTGGAAGGGGCTGCTGTGG + Intronic
992320810 5:75611682-75611704 GCTGCTGCTCCGGGCTGCTGCGG + Exonic
993020311 5:82584214-82584236 GCTCTACCATAGGGCTGCTGCGG + Intergenic
993494083 5:88587420-88587442 ACTCTTCCATAGGGCTGCTGTGG - Intergenic
996054704 5:118969573-118969595 ACTCTTCCATAGGGCTGCTGTGG - Intronic
998160358 5:139809566-139809588 GCTCGTGCCCTGGGCTGCAGAGG - Exonic
999452961 5:151692195-151692217 ACTCTTTCACAGGACTGCTGTGG - Intergenic
999633485 5:153596446-153596468 CCTCTTTCACAGGCCTGCTGTGG - Intronic
1001686205 5:173596800-173596822 GCTGCTTCACGGGGATGCTGTGG - Intergenic
1004034832 6:11913887-11913909 GCTCTAGCAAAGGACTGCTGGGG - Intergenic
1006154586 6:32007370-32007392 GCACTTGCACATGGCTGCAGTGG + Intergenic
1007344902 6:41222298-41222320 CCTCCTGCTCGTGGCTGCTGGGG - Intergenic
1009707035 6:67265825-67265847 CCTCTTTCATAGGGCTGCTGTGG + Intergenic
1010279351 6:74006123-74006145 GCTCTTGCACAGGGCCAATGGGG + Intergenic
1013605024 6:111739448-111739470 GCTCCTGCCTGGGGATGCTGTGG + Intronic
1017536025 6:155348959-155348981 ACTTTTGCATAGGGCTGCTGTGG + Intergenic
1017633842 6:156424326-156424348 GCTCTTGCAGGGGCCAGCTCAGG - Intergenic
1018091220 6:160348219-160348241 CCTGTGGCCCGGGGCTGCTGCGG + Intergenic
1018851526 6:167643953-167643975 GCTCTGGCTCGGAGCTGCTGTGG - Intergenic
1019190807 6:170249552-170249574 GCCCATGCACGGGGCAGGTGTGG - Intergenic
1020619204 7:10497382-10497404 CCTCTTTCACAGGGTTGCTGTGG - Intergenic
1021187080 7:17576577-17576599 CCTCTTCCACAGGGCAGCTGTGG - Intergenic
1022883923 7:34622199-34622221 GCACTGGCATGGGGCTGCAGGGG - Intergenic
1023266293 7:38409689-38409711 GCTCTGGGACCCGGCTGCTGAGG - Intronic
1023841744 7:44102072-44102094 GCTCTGCCACGGGGCCGGTGAGG - Intergenic
1028027755 7:85867323-85867345 CCTCTTCCATAGGGCTGCTGCGG - Intergenic
1030455423 7:109766855-109766877 TCTTTTCCATGGGGCTGCTGTGG - Intergenic
1031934928 7:127726633-127726655 TCTATTGCCCAGGGCTGCTGTGG + Intronic
1034496788 7:151427876-151427898 GCTCTTGGCTGTGGCTGCTGGGG - Intergenic
1037249478 8:16876557-16876579 CCTCTTCCATAGGGCTGCTGTGG + Intergenic
1037287478 8:17316927-17316949 GCTCTTGAAAAGGGCTGCAGTGG + Intronic
1037329301 8:17728125-17728147 GCGCTTGCCAGGGGCTGGTGGGG + Intronic
1037421745 8:18709739-18709761 CCTCTTCCATAGGGCTGCTGTGG - Intronic
1038205005 8:25458007-25458029 GCTCGGGCACGGGGGTCCTGAGG + Intronic
1039921323 8:41896296-41896318 GCACCTGCAAGTGGCTGCTGGGG - Intronic
1040841932 8:51793213-51793235 CCTCTTTCATAGGGCTGCTGTGG - Intronic
1041019532 8:53624469-53624491 GTTCTTGCCTGGGGCTGATGTGG - Intergenic
1041889948 8:62858098-62858120 GCTGTTGCATAGGGCTGCTGTGG + Intronic
1041961923 8:63627819-63627841 GCTCTTGGAGGGAGCTGCTCTGG - Intergenic
1044423147 8:92021974-92021996 GCTGTTGCTCGGGGCAGTTGAGG - Intronic
1045377648 8:101591257-101591279 GCTTCTGCAAAGGGCTGCTGAGG - Intronic
1049242686 8:141546396-141546418 GGCCTTGCACAGGGTTGCTGAGG + Intergenic
1049690887 8:143958374-143958396 ACTCTTGTACTGGGCTGCAGGGG - Intronic
1050240108 9:3626057-3626079 ACTCTTCCGCAGGGCTGCTGTGG + Intergenic
1051742471 9:20265089-20265111 GCTCTTGCAGCGGGCTACAGCGG + Intergenic
1052387040 9:27835107-27835129 CCTCTTCCATAGGGCTGCTGTGG + Intergenic
1052703002 9:31960330-31960352 TCTTTTCCACAGGGCTGCTGTGG - Intergenic
1054745422 9:68849494-68849516 GCTCTTGCCTGGGGAGGCTGAGG - Intronic
1055443391 9:76358601-76358623 GCTTCTGCTCGGGGCAGCTGTGG + Exonic
1055509698 9:76984299-76984321 ACTCTTCCATAGGGCTGCTGTGG + Intergenic
1056463106 9:86827041-86827063 GCACTCACACAGGGCTGCTGTGG - Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1058530260 9:105899668-105899690 CCTCTTTCATAGGGCTGCTGTGG + Intergenic
1060295771 9:122342013-122342035 GCTCACGCATGGGGCTGATGAGG + Intergenic
1061594724 9:131621536-131621558 CCTGCTGCGCGGGGCTGCTGTGG + Intronic
1062421994 9:136487095-136487117 GCCCTTGCTCTCGGCTGCTGGGG + Intergenic
1062570761 9:137184135-137184157 GCTCTTGCAGGGGGGTGCACCGG - Intronic
1203516443 Un_GL000213v1:6156-6178 GCTGTTGCATGGGATTGCTGAGG + Intergenic
1203465366 Un_GL000220v1:81117-81139 GCTCTTTCACGGGACTGGAGTGG + Intergenic
1186593348 X:10953858-10953880 ACTCTTCCATAGGGCTGCTGTGG - Intergenic
1186808213 X:13161260-13161282 GCTCTTGCAGGGGGCCTTTGTGG + Intergenic
1186913293 X:14193059-14193081 CCTCTTCCATAGGGCTGCTGTGG + Intergenic
1190803258 X:53812683-53812705 ACTCTTCCACAGGGCTGCTGTGG + Intergenic
1192235307 X:69291787-69291809 GCTCTTGCAAGGGAAGGCTGTGG - Intergenic
1192560273 X:72123761-72123783 GCTCTTGCAGTGGGCTGTTCGGG - Intergenic
1194405804 X:93494354-93494376 CCTCTTCCATAGGGCTGCTGTGG - Intergenic
1195465234 X:105172425-105172447 GCTCTTACATAGGGCTTCTGGGG + Intronic
1195687821 X:107601879-107601901 CCTGCTGCACAGGGCTGCTGCGG - Exonic
1196150712 X:112370290-112370312 CCTCTTTCAGGAGGCTGCTGGGG - Intergenic
1196168059 X:112556292-112556314 CCTCTTCCATAGGGCTGCTGTGG - Intergenic
1198786996 X:140299602-140299624 GCTCCTGCCCAGGGCGGCTGCGG - Intergenic
1199079603 X:143561775-143561797 CCTCTTCCCCAGGGCTGCTGAGG - Intergenic