ID: 1107733392

View in Genome Browser
Species Human (GRCh38)
Location 13:43370872-43370894
Sequence ATATAGAAGCTACAGTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107733392 Original CRISPR ATATAGAAGCTACAGTTTGT GGG (reversed) Intronic
908251764 1:62271490-62271512 AAAAAGAACCTTCAGTTTGTTGG - Exonic
908390739 1:63681322-63681344 ATATAGAAGCTTCAAGTTCTGGG - Intergenic
908677784 1:66625116-66625138 ATATAAGAGCAACATTTTGTGGG + Intronic
909214192 1:72864930-72864952 ACTTAGAAGCAACAGCTTGTTGG - Intergenic
911296656 1:96125754-96125776 ATGTAGAAGCTACAGAAAGTTGG + Intergenic
911585552 1:99686038-99686060 TTATAGAGGCTACATTTTCTGGG - Intronic
912946774 1:114091677-114091699 AAATACAAGGTACAGTTTTTTGG - Exonic
913438704 1:118874484-118874506 CTAAAGAAGCTACAGTCTTTGGG - Intergenic
914629221 1:149492898-149492920 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914629754 1:149497655-149497677 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914630289 1:149502416-149502438 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914630823 1:149507177-149507199 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914631354 1:149511938-149511960 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914631886 1:149516694-149516716 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914632422 1:149521449-149521471 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914632957 1:149526200-149526222 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914633492 1:149530929-149530951 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914634028 1:149535684-149535706 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914634561 1:149540431-149540453 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914635096 1:149545168-149545190 ATATTGGAGCAACAGTGTGTTGG + Intergenic
914635631 1:149549905-149549927 ATATTGGAGCAACAGTGTGTTGG + Intergenic
917239288 1:172930057-172930079 TTATAGAAGCTACAGAGGGTGGG + Intergenic
918872569 1:189994499-189994521 ATATAGCAGCCACAGATTGCTGG - Intergenic
924747435 1:246849147-246849169 ATGTAGATGCGCCAGTTTGTGGG + Intronic
1063569571 10:7202421-7202443 ATAAAGACACTACAGTTTATCGG + Intronic
1064918494 10:20489053-20489075 ATATCTAACCTACAGTTTGAGGG - Intergenic
1065236362 10:23656953-23656975 ACATAGAAACTACTTTTTGTTGG + Intergenic
1065390738 10:25177999-25178021 ATTTAAAGGCTACAGTTTGCTGG - Intronic
1070833512 10:79434248-79434270 ATACAGAAGTTACAGTCAGTTGG - Intronic
1078947743 11:16089723-16089745 ATTGAGAAGCTACAGTTGGATGG - Intronic
1080781184 11:35431426-35431448 ACAGTGAAGCTACAGTTTCTTGG + Intergenic
1082216064 11:49571285-49571307 ACACAGAAGGTACAGTGTGTAGG - Intergenic
1083707188 11:64524746-64524768 TTATGGAAGCTTCACTTTGTAGG - Intergenic
1086454213 11:86945584-86945606 AAATAGAGGATTCAGTTTGTAGG - Intronic
1086633517 11:89053189-89053211 ACACAGAAGGTACAGTGTGTAGG + Intronic
1086749666 11:90475821-90475843 ATACAGAATATACAGTTTGGTGG - Intergenic
1086965508 11:93023799-93023821 ATATAGGAGATACAATTTTTAGG - Intergenic
1087555665 11:99717084-99717106 ATATACAATATACAATTTGTGGG - Intronic
1088885692 11:114004674-114004696 ACATAGAAAGTACAGCTTGTAGG - Intergenic
1092085115 12:5750659-5750681 ATCTAGGAGCTACAGATTCTGGG - Intronic
1092979995 12:13785009-13785031 ACATAAAAGCAACATTTTGTGGG - Intronic
1095870682 12:47024259-47024281 TTATATAAGCTATTGTTTGTAGG + Intergenic
1101500432 12:105299046-105299068 ATACAGAAGAAACAGTTTTTTGG - Intronic
1102712559 12:114940849-114940871 ATGTATAAGCTAGAGTTTCTTGG - Intergenic
1105649894 13:22365010-22365032 GTATTGAATCTACAGATTGTGGG - Intergenic
1107457030 13:40564485-40564507 TTAAAGAAGCTACGGTTTCTAGG + Intronic
1107733392 13:43370872-43370894 ATATAGAAGCTACAGTTTGTGGG - Intronic
1107799465 13:44090772-44090794 AAACAAAAGCTACATTTTGTTGG + Intergenic
1108136602 13:47369787-47369809 ATAAAGAAGCTACAATTTTCTGG + Intergenic
1110975373 13:81826847-81826869 ATATAGCAGCTATAGTATTTGGG + Intergenic
1111233829 13:85381701-85381723 ATTTAGAAGCTATCATTTGTAGG - Intergenic
1111401566 13:87743404-87743426 ATATAGAAGCAACAGTTATATGG - Intergenic
1112612875 13:100973256-100973278 TTATAGAAGCTTCATTATGTAGG + Intergenic
1113062668 13:106340098-106340120 CTATGGGAGCTAGAGTTTGTAGG + Intergenic
1114845683 14:26318455-26318477 TTATAGAAGCTAGAGATTGTGGG + Intergenic
1115282018 14:31674834-31674856 GTATAAAAGTTACAGTTTATTGG + Intronic
1116683492 14:48008672-48008694 ATATGGAACCTACAGTATGTGGG - Intergenic
1117239517 14:53815555-53815577 ATATAGAAACTACATTTTGTTGG + Intergenic
1119621801 14:76137136-76137158 ATACAGAACCCAGAGTTTGTTGG + Intergenic
1125306697 15:38325427-38325449 ATATAGAAAGTAAAGTTTCTGGG + Intronic
1126621328 15:50642912-50642934 ATAAATAATCTACAGTTTGTAGG - Intronic
1126812093 15:52417415-52417437 TAATAGGAGCTAGAGTTTGTGGG - Intronic
1127089281 15:55450733-55450755 ATATAGGAGATAAAGTATGTAGG - Intronic
1128904752 15:71456938-71456960 CTCCAGAAGCTACAGTTTCTAGG + Intronic
1129420333 15:75420040-75420062 ATTTAGAAGCTACAGATTTAAGG + Intronic
1129556433 15:76515083-76515105 AATTATAAGCTACAGTTTGAAGG + Intronic
1131681837 15:94731694-94731716 AAATAAAAATTACAGTTTGTTGG + Intergenic
1133132942 16:3689161-3689183 AAATAGAAGTTAAACTTTGTTGG - Intronic
1133748020 16:8702140-8702162 GTATAGCAGCTTCTGTTTGTGGG + Intronic
1137337127 16:47560887-47560909 AGATAGAAGATATATTTTGTGGG + Intronic
1138620517 16:58207352-58207374 ATAGAGAAGCTAGTGTCTGTCGG - Intergenic
1138724985 16:59126209-59126231 ATATAGAAGATACAGTTAAAGGG + Intergenic
1138790771 16:59901916-59901938 TTATAGAAGTTACAGATTCTAGG + Intergenic
1140785544 16:78337787-78337809 ATCTTGAAGCTAGAGTTTCTTGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143717173 17:8782449-8782471 ATGTGGAAGCTACAGCTGGTTGG - Intergenic
1146676683 17:34778545-34778567 TCAAGGAAGCTACAGTTTGTTGG + Intergenic
1151806834 17:76411008-76411030 ATAAAGAAGCTACTTTTTTTTGG + Intronic
1154310009 18:13260055-13260077 ATATAGCAGGTAGATTTTGTAGG + Intronic
1157158261 18:45288550-45288572 ATAGAGAAGCTAGAGATTGTAGG - Intronic
1158076926 18:53541605-53541627 ATATGGAAACTAAAGTATGTCGG + Intergenic
1159201157 18:65186105-65186127 ATATAGTAGCCACTGTTTTTTGG + Intergenic
1159803890 18:72931085-72931107 ATAGAGAAGCTTCAGATTATAGG + Intergenic
1161911942 19:7200431-7200453 ATATAGAGGCTGCACTTTGGAGG + Intronic
1162866659 19:13553087-13553109 TTATGGAAGCTTCATTTTGTAGG + Intronic
1168541953 19:57220343-57220365 ATGTAGAAGATACAGTGTCTGGG + Exonic
1168555097 19:57331672-57331694 ATGTAGAAGATAAAATTTGTAGG - Intergenic
925134653 2:1517892-1517914 AGATAGAGGCCACAGTTTCTCGG + Intronic
925574333 2:5345195-5345217 ACATAAAGGCTACAGTTTGCTGG - Intergenic
925959504 2:9002931-9002953 AGACAGAGGCAACAGTTTGTGGG - Intronic
926510460 2:13770809-13770831 ATATACAATCAACATTTTGTGGG - Intergenic
930933742 2:56920590-56920612 TTATTGAAGCTTCATTTTGTAGG - Intergenic
932855699 2:75232083-75232105 AGAGACAAGCTTCAGTTTGTGGG - Intergenic
937038539 2:118802799-118802821 AGATACAAACTAAAGTTTGTTGG - Intergenic
939246020 2:139624717-139624739 ATATGCAATTTACAGTTTGTTGG + Intergenic
940671852 2:156679660-156679682 ATATAGAAATTACAGATTGGAGG - Intergenic
941021365 2:160410285-160410307 TTATAGAACATACATTTTGTTGG - Intronic
943121078 2:183736834-183736856 ATATATAAGCTTCAATTTATAGG - Intergenic
943608385 2:190003405-190003427 ATATAAATGCAAAAGTTTGTTGG - Intronic
945866331 2:215180564-215180586 GTATAAAAGATACATTTTGTAGG + Intergenic
945897792 2:215504154-215504176 ATTTAAAAGCAAAAGTTTGTGGG - Intergenic
947501774 2:230676126-230676148 ACATAGATCCTACAGTATGTGGG + Intergenic
947502153 2:230678950-230678972 ACATAGATCCTACAGTATGTGGG + Intergenic
948970269 2:241420311-241420333 GTATAGTAGCTACTGCTTGTGGG + Intronic
1169475663 20:5929109-5929131 AAAAAGAATCTTCAGTTTGTTGG - Intergenic
1174212480 20:48890813-48890835 TTATAGAATCTCAAGTTTGTTGG - Intergenic
1177149238 21:17438026-17438048 AAATAGAGCCCACAGTTTGTGGG + Intergenic
1179384114 21:40925732-40925754 ATAAAGAAGCTAGAGTTTCAGGG + Intergenic
1183222064 22:36521432-36521454 AAAGTGAAGCTACATTTTGTTGG - Intronic
952466520 3:33593390-33593412 AGATAAAAGATACAATTTGTAGG + Intronic
956072449 3:65467992-65468014 ATAGAGAAGCTAAAGTTCTTGGG - Intronic
958056956 3:88426019-88426041 ATATATCAGCTACAGTTTCATGG + Intergenic
958499786 3:94890351-94890373 ACATAGCAGATACAGTTTTTGGG + Intergenic
958667085 3:97155032-97155054 ATATAGAAGCTTCAAAGTGTTGG - Intronic
958980338 3:100711534-100711556 ATAAAGAAGGTACAGTGTGAGGG + Intronic
960388908 3:117052693-117052715 AAATAGAATCTACATTTTGATGG + Intronic
962300273 3:134234934-134234956 ATATAAAAGATATAGTTTATAGG + Intronic
962382329 3:134908227-134908249 ATCTAGAGGCTTCAGTGTGTCGG + Intronic
964201981 3:154128088-154128110 ATATAAATCCTTCAGTTTGTAGG + Intronic
964745184 3:160005776-160005798 TTATAGAAGCTTTAATTTGTAGG - Intergenic
964925901 3:161956593-161956615 AAAGAGAAGCTACACTTTTTAGG + Intergenic
966098288 3:176233072-176233094 ATGTACAACCTACGGTTTGTAGG + Intergenic
966138564 3:176729076-176729098 ATAAAGAAGAAATAGTTTGTTGG - Intergenic
967925548 3:194643183-194643205 ATATCACAGCTACAATTTGTAGG - Intronic
971227632 4:24769604-24769626 AGATAGAAATTACAGTTTGCTGG - Intergenic
974819716 4:67051107-67051129 ATATTCAAGCTACACCTTGTGGG - Intergenic
976863367 4:89693008-89693030 TTAAAGAAATTACAGTTTGTTGG + Intergenic
977439735 4:97049309-97049331 AAATTGAACCTGCAGTTTGTAGG - Intergenic
979127615 4:116995552-116995574 ATATATAAAATACAGTTTTTTGG - Intergenic
979574387 4:122270623-122270645 ATATATTAGATACAGATTGTAGG + Intronic
981723826 4:147827501-147827523 GTATTGGAGCTAGAGTTTGTGGG + Intronic
982284537 4:153721417-153721439 ATTTAGAAGGTACAGATTTTTGG + Intronic
982957732 4:161792638-161792660 ATATAGAAGCTACCCACTGTGGG + Intronic
984370192 4:178854225-178854247 ATTGAGAGCCTACAGTTTGTGGG + Intergenic
987805499 5:22760239-22760261 ATAAAGACAATACAGTTTGTTGG + Intronic
989664864 5:43842172-43842194 AAATAGAATCCCCAGTTTGTAGG - Intergenic
992011478 5:72531979-72532001 ATATAGAAGAGGCAGTTTCTGGG + Intergenic
992298264 5:75349494-75349516 ATATTGAAATTAGAGTTTGTTGG + Intronic
992615960 5:78546490-78546512 TAATAGAACCTACATTTTGTAGG + Intronic
993032796 5:82724339-82724361 ATATAGAAGTTATATTTTTTAGG - Intergenic
995857337 5:116607242-116607264 ATATTGAAGCTACTTTTTGTTGG - Intergenic
996747834 5:126860290-126860312 ATAAATAAACTACAGTTTATTGG - Intergenic
1000948277 5:167449129-167449151 ATGTAAAAGCTAAAGCTTGTAGG + Intronic
1003039693 6:2676184-2676206 GTAATGAAGCTTCAGTTTGTAGG + Intronic
1004713089 6:18191148-18191170 ATTTGGAAGTTACAGCTTGTAGG + Intronic
1004805239 6:19196821-19196843 ATATAGCAGATACAATTTGAGGG + Intergenic
1009197011 6:60698805-60698827 TTATATAACCTACAGTTTCTTGG + Intergenic
1010297075 6:74210742-74210764 ATATTTAAGCTACATTTTGAAGG - Intergenic
1012138168 6:95584909-95584931 GAATAGAAGCAGCAGTTTGTAGG + Intronic
1013659855 6:112284112-112284134 ATATTGAAGCTCCAGGTTTTGGG + Intergenic
1013988326 6:116223694-116223716 ATAGAGAAGTTATAGTTTTTGGG + Intronic
1015305085 6:131697980-131698002 ACTTAGAAGCCACAGTTTCTAGG + Intronic
1016530022 6:145048819-145048841 AAATAAAAGCTAAAGTATGTTGG - Intergenic
1018973151 6:168543045-168543067 ATATAGTGGCTTCAGTCTGTTGG + Intronic
1020828891 7:13067836-13067858 ACAGAGAAGCTACATTTTGGAGG + Intergenic
1020973191 7:14973061-14973083 AAATAGAAACTATAATTTGTAGG + Intronic
1021042560 7:15881099-15881121 ATATATATTCTGCAGTTTGTTGG - Intergenic
1021620574 7:22547487-22547509 ATATAAAAGTTAAAGTTTTTTGG + Intronic
1022324658 7:29320282-29320304 AATTAGAAGCCACAGTTTGGTGG - Intronic
1024657197 7:51460950-51460972 ATAAACAAGCTGCAGTTTGCAGG - Intergenic
1030739031 7:113086340-113086362 AGAAAGAAGCTATAGTCTGTCGG - Intronic
1030964887 7:115979462-115979484 ATATAGGAGCTTCAGGTTGAGGG - Intronic
1032914710 7:136476965-136476987 GTATAGAAGCCACAGTCTTTGGG + Intergenic
1033050972 7:138003723-138003745 AAATAGAAGCTCTAGTTTATGGG + Intronic
1034905394 7:154940342-154940364 ACATAGAAGCCACAGGTTCTGGG + Intronic
1036469003 8:9033229-9033251 ATATAAAAACCATAGTTTGTAGG - Exonic
1036567338 8:9948773-9948795 ATAAAGAAGCTTCATTTTGTTGG + Intergenic
1041981466 8:63866211-63866233 AAACAGAAGCTATAGTTTATTGG - Intergenic
1045214584 8:100134682-100134704 ATATATAATCTAGACTTTGTGGG + Intronic
1045949594 8:107836713-107836735 ATTTAGAATCTAAAGTATGTTGG + Intergenic
1048836407 8:138522904-138522926 ATATGAAAGCTATTGTTTGTGGG - Intergenic
1048955350 8:139531472-139531494 ATATAAAAGCAAGAGCTTGTAGG + Intergenic
1049960229 9:731232-731254 AAAAAGAATCTTCAGTTTGTTGG + Exonic
1050336608 9:4595725-4595747 ATACAGAAGCAACAGTATCTTGG + Intronic
1052242932 9:26296652-26296674 AGATAGAAGAAAGAGTTTGTAGG - Intergenic
1054942894 9:70763187-70763209 ATATAGAATATACACTTTGTAGG - Intronic
1055545329 9:77365257-77365279 ATATAGAAGATAATGCTTGTTGG + Intronic
1058394196 9:104531084-104531106 ATATAAAAGGTACAGTTTCATGG + Intergenic
1060086072 9:120703255-120703277 AAAAAGAAGGAACAGTTTGTAGG - Intronic
1060563456 9:124567769-124567791 ATAGAGAAAATACATTTTGTAGG + Intronic
1060900710 9:127255289-127255311 ATATAGCAGCTAAAGTGGGTGGG + Intronic
1185715933 X:2342107-2342129 ATTTAGAAGCTTTTGTTTGTGGG + Intronic
1186024367 X:5292583-5292605 ATGTGGAAGGTATAGTTTGTGGG + Intergenic
1186706203 X:12141326-12141348 ATTTAGAAGCTCAAGTTTGTAGG - Intronic
1187354104 X:18550505-18550527 ATTTAAAAGCTACATTTTCTTGG + Intronic
1192144670 X:68673712-68673734 CTGTAGAAGCTCCAGATTGTAGG - Intronic
1194230164 X:91311992-91312014 ATATGAAACCTACAGTATGTGGG + Intergenic
1194830525 X:98618424-98618446 ATAGGGATGCTGCAGTTTGTTGG + Intergenic