ID: 1107735093

View in Genome Browser
Species Human (GRCh38)
Location 13:43391065-43391087
Sequence TCCCCACAGCTCCCCCAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107735091_1107735093 -5 Left 1107735091 13:43391047-43391069 CCACTGACCTGACTTCTATCCCC 0: 1
1: 0
2: 4
3: 57
4: 387
Right 1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG 0: 1
1: 0
2: 0
3: 26
4: 304
1107735090_1107735093 -4 Left 1107735090 13:43391046-43391068 CCCACTGACCTGACTTCTATCCC 0: 1
1: 0
2: 1
3: 10
4: 179
Right 1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG 0: 1
1: 0
2: 0
3: 26
4: 304
1107735087_1107735093 27 Left 1107735087 13:43391015-43391037 CCCGTTTCTTATGATATTGTTCA 0: 1
1: 0
2: 0
3: 15
4: 275
Right 1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG 0: 1
1: 0
2: 0
3: 26
4: 304
1107735089_1107735093 3 Left 1107735089 13:43391039-43391061 CCTTTAACCCACTGACCTGACTT 0: 1
1: 0
2: 1
3: 15
4: 137
Right 1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG 0: 1
1: 0
2: 0
3: 26
4: 304
1107735088_1107735093 26 Left 1107735088 13:43391016-43391038 CCGTTTCTTATGATATTGTTCAA 0: 1
1: 0
2: 1
3: 38
4: 514
Right 1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG 0: 1
1: 0
2: 0
3: 26
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107735093 Original CRISPR TCCCCACAGCTCCCCCAGAA CGG Intronic
901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG + Intronic
901970610 1:12904776-12904798 TCTCCAGAGATGCCCCAGAAAGG + Intronic
902014555 1:13296994-13297016 TCTCCAGAGATGCCCCAGAAAGG - Intergenic
902402695 1:16166762-16166784 TCCCCACCACCCCCCCAAAAAGG - Intergenic
902466532 1:16621985-16622007 TGCCCACTGCTCCCGCAGAGAGG + Intergenic
902893998 1:19466204-19466226 GCTCCACAGCTCCGCCAGGAGGG + Intronic
903577834 1:24350185-24350207 TCCCCTCAGCCCCTCCACAAAGG - Intronic
904344114 1:29856934-29856956 TCCTCAGAGCTCCCCCAGAGAGG - Intergenic
904490465 1:30855705-30855727 TCCCCACAGGTCCCTCAGCCAGG - Intergenic
904527180 1:31142534-31142556 TCCCCACAGTTCCTCTAGATAGG - Intergenic
904598014 1:31658829-31658851 TCCCCCCAGCTTCCTCTGAATGG + Intronic
904762947 1:32818176-32818198 TCCCCGCCCCTCCCCCAGTAGGG - Intronic
905626525 1:39493195-39493217 GCCCCACAGCTCCCCCACTTCGG - Intronic
906033048 1:42735411-42735433 TCCTCACAGCAACCCCACAAGGG - Intronic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
907824695 1:58004192-58004214 TCTTCACAGCCACCCCAGAAGGG + Intronic
908143022 1:61207478-61207500 TCCTCCCAGCTCCCCCAGTGTGG + Intronic
908513554 1:64869902-64869924 TCCCTAGAGCTACACCAGAATGG - Intronic
909102713 1:71369900-71369922 TCACCCCAGAGCCCCCAGAAAGG - Intergenic
912084532 1:105982268-105982290 TTCTCACAGCTCCCCCAGGCAGG - Intergenic
915074186 1:153295383-153295405 ACCCCACCCCTCCACCAGAAGGG + Intergenic
915251196 1:154589915-154589937 TCCCCACAGCTCCCTCTCACTGG - Exonic
915332594 1:155122533-155122555 TCCCCACATCCCACTCAGAAGGG - Intergenic
915513715 1:156400888-156400910 TCCCCACAGCTTCTCCACAAAGG + Intergenic
915613283 1:157013480-157013502 TCCCTACCTCTCCCCCAGCATGG + Intronic
915934062 1:160080306-160080328 TCCCCACACATCCACCAGAATGG - Intergenic
917034703 1:170735650-170735672 TCCCCACTGCTCCCACAGGCTGG + Intronic
918075984 1:181171907-181171929 TCCCCACTGCTGCCCTACAAGGG - Intergenic
920345607 1:205303997-205304019 GCCCCCCTGCTCCCCAAGAAGGG - Exonic
920666377 1:207965621-207965643 TCCCCAGATCTCTCCCAAAAAGG + Intergenic
921033750 1:211356786-211356808 CCCACACAGTTCCCCCAAAATGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923805320 1:237251332-237251354 TCCCCACAGCTCCACTGAAATGG + Intronic
1062836246 10:637772-637794 TCCACACAGTTCTCCCAAAAGGG + Intronic
1063131500 10:3181845-3181867 TCCTCACTGTTCCCCAAGAAGGG - Intergenic
1063411635 10:5840817-5840839 TGCCCACAGACCCCCCAGACAGG - Intronic
1064008630 10:11717485-11717507 TCGCCACTTCTCTCCCAGAAGGG + Intergenic
1064348160 10:14551853-14551875 TCCCCAGTTCTCCCCCAAAAAGG + Intronic
1064554996 10:16539133-16539155 TCCCCAAGGGTCCCACAGAATGG - Intergenic
1065322807 10:24524669-24524691 TCCCCACAGATACCCATGAATGG + Exonic
1065688289 10:28307732-28307754 TTCCCTCTGCTTCCCCAGAAAGG + Intronic
1065800193 10:29344804-29344826 ACCCCCCACCTCCCCCAGGAGGG - Intergenic
1067039814 10:42943293-42943315 CCCGCACAGCTCCCGGAGAAGGG - Intergenic
1067054050 10:43041050-43041072 TCCTCTCAGCTCCCCCAGCATGG - Intergenic
1067443469 10:46326383-46326405 TCCCCACAGATCCCTCAGGCTGG + Intronic
1068286402 10:54942275-54942297 AACCCACATCTCCCTCAGAATGG - Intronic
1069602632 10:69717790-69717812 TTCCTCCAGCTCCCCCAGGATGG + Intergenic
1070337560 10:75468738-75468760 TCCCCACTCCACCCCCAGCAGGG - Intronic
1070550619 10:77488249-77488271 TCCTCACAGCTCCTCCTAAAGGG - Intronic
1070622954 10:78028057-78028079 TCCACACAGCTGCCCAAGCAAGG + Intronic
1071490452 10:86132873-86132895 TCCCAACACCTCTCCCAGATTGG - Intronic
1072766234 10:98097206-98097228 CTCACAGAGCTCCCCCAGAATGG + Intergenic
1073693222 10:105834858-105834880 ACCCCACAACTCCCACAGATGGG - Intergenic
1074495752 10:113978873-113978895 TCCCCACTGCTCTTACAGAAGGG - Intergenic
1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG + Intronic
1075465880 10:122649855-122649877 TGCCTACAGCTCACCCAGAAAGG + Intergenic
1076420921 10:130331066-130331088 TCCCCACCCCTCCCCCACCATGG + Intergenic
1076853799 10:133105623-133105645 TCCCCCCTGCTCACACAGAAAGG - Intronic
1076893608 10:133297678-133297700 GCCCCACAGCTCTGGCAGAAGGG + Intronic
1077059553 11:611834-611856 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077059567 11:611873-611895 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077269737 11:1670192-1670214 GCTCCACAGTTCCCCCACAAAGG + Intergenic
1077487376 11:2845297-2845319 TCCCCACAGCTCCCACCCCAAGG - Intronic
1077614603 11:3666054-3666076 CAGCCACAGCTCCTCCAGAAAGG - Exonic
1077672177 11:4166793-4166815 ACCCCACTGCTGCCCCAGAATGG + Intergenic
1080822922 11:35824354-35824376 TCCTCACAGCACCCCCACAAGGG + Intergenic
1081196901 11:40172382-40172404 TCCCCACAGAACAGCCAGAATGG + Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1084712669 11:70853553-70853575 TCCCAACAGCTCCACCAGCCCGG + Intronic
1084796001 11:71504457-71504479 TCTCCACAGCATCCCCAGGATGG - Intronic
1084994463 11:72962165-72962187 ACCCCACAGGTCCCCTAAAAGGG - Intronic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090513402 11:127399172-127399194 TATCCACAGCTCCTCCAGGATGG + Intergenic
1091347589 11:134865462-134865484 GCCCCACAGTTCCCCAGGAATGG - Intergenic
1091705855 12:2692473-2692495 TTCCCACAGCTAAACCAGAAAGG - Intronic
1098443175 12:70539162-70539184 TCCCCACAACAGCCCCACAAGGG + Intronic
1099013748 12:77321930-77321952 TCACCACCCCTCTCCCAGAAGGG - Intergenic
1100391426 12:94148823-94148845 TCCCCGCAGCTCGCCCAGGAAGG - Exonic
1101330282 12:103751877-103751899 ACCACACAGCTCCAACAGAAGGG - Intronic
1101675763 12:106914818-106914840 GCCCCTCAGGTCTCCCAGAAAGG + Intergenic
1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG + Intronic
1102033565 12:109758581-109758603 TCCCCACACCCCTCCCATAAAGG + Intronic
1104055232 12:125225008-125225030 ATCCCACACCTCCACCAGAAAGG - Intronic
1104711230 12:130988158-130988180 TATCAACACCTCCCCCAGAAAGG - Intronic
1106164186 13:27227656-27227678 TCCACAAAGCTCCCCTAAAAAGG + Intergenic
1106409113 13:29498812-29498834 TCCCCACACGTCCCCAAGAGAGG - Intronic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1107561445 13:41560677-41560699 TCCTCACAGCTCCTTCAGACAGG - Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1108363432 13:49688149-49688171 TGCCCACAGCGACCTCAGAATGG + Intronic
1108395093 13:49984087-49984109 TCCTCACAGCAACCCCACAAGGG - Intergenic
1112322789 13:98422325-98422347 TCCCCACTGCTCCCCTGAAAAGG - Intronic
1112535596 13:100251984-100252006 CCCCCTCAGCCTCCCCAGAAGGG - Intronic
1112952771 13:105021841-105021863 TCCCAACATCTCCACCAGAGTGG + Intergenic
1113092592 13:106630860-106630882 TCTCCACAGCTTCCCCAGCGAGG + Intergenic
1113421666 13:110175909-110175931 TCCTCAGAGCTCACTCAGAAAGG - Intronic
1113571957 13:111364187-111364209 TCCCCAAAACTCACCCAGAATGG + Intergenic
1113847629 13:113401635-113401657 TCCCCACAGCTCCCCCGACAGGG - Intergenic
1117953856 14:61107867-61107889 TGCCCACTGCTCCACCAGCAAGG - Intergenic
1119768302 14:77204615-77204637 TCCCCACACCTCCCCGCAAAGGG - Intronic
1121427120 14:93860281-93860303 TCCTCACAGCTGCCCTGGAAGGG + Intergenic
1121735064 14:96212736-96212758 TTCCATCAGCACCCCCAGAAAGG + Intronic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122249235 14:100426629-100426651 GCCCCACAGCTATCCTAGAATGG + Intronic
1122371866 14:101233475-101233497 TTTCAACAGTTCCCCCAGAATGG - Intergenic
1123028156 14:105438343-105438365 CCCCCACAGCTTCCCCAAGAAGG + Intronic
1123139451 14:106061215-106061237 TACCCAGAGCTCACCCACAATGG + Intergenic
1123477117 15:20598003-20598025 TCCCCACAGCGCCCCCTTATGGG + Intergenic
1123640896 15:22402361-22402383 TCCCCACAGCGCCCCCTTATGGG - Intergenic
1124230388 15:27940314-27940336 TCCCTACTGGACCCCCAGAAAGG + Intronic
1124364574 15:29062884-29062906 TCCCCACAGCCCCACGAGATGGG - Intronic
1124569406 15:30848378-30848400 TCCCCAGAGCTCACACAGCAGGG + Intergenic
1124880669 15:33639673-33639695 TCCCCACTGCTTCCCCAAAAGGG - Intronic
1126798551 15:52280283-52280305 GGCTCACAGCTCCCCCAGCAGGG + Intronic
1126916878 15:53475672-53475694 TCCCCCCCACCCCCCCAGAAAGG + Intergenic
1128347327 15:66862705-66862727 TCACCACTGCTACCCCAAAAAGG - Intergenic
1129295848 15:74599658-74599680 TCCCCTAATCTGCCCCAGAAAGG - Intronic
1129694517 15:77733101-77733123 CCCCCACAGCTCCCCCATCTAGG + Intronic
1130985571 15:88842538-88842560 TGCCCACAGCTCCTCCAGGCTGG + Intronic
1130996873 15:88908937-88908959 TCCCCACATCTCCCTGAGGAGGG + Intronic
1132146516 15:99432842-99432864 TGCCCACTGCTGCCCCAAAAAGG - Intergenic
1132652311 16:1027065-1027087 TCCCCACAGGACCCACAGAGCGG + Intergenic
1132680086 16:1136581-1136603 TCCCCACACCCCCAGCAGAAGGG - Intergenic
1133270347 16:4608288-4608310 GCCTCACAGCTCCCCAAGAGTGG - Intergenic
1135714450 16:24749579-24749601 TCTCTAGAGCTCCACCAGAAAGG + Intronic
1136429070 16:30186520-30186542 TCCCCACACCTCCTTCAGAGAGG - Intronic
1136690483 16:32024960-32024982 CCCCCTCACCTCCCCCACAAAGG + Intergenic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1136763836 16:32757869-32757891 TCACCACTGCTCCCACAGATGGG + Intergenic
1136791068 16:32968520-32968542 CCCCCCCACCTCCCCCACAAAGG + Intergenic
1136804263 16:33112517-33112539 TCACCACTGCTCCCACAGATGGG - Intergenic
1137542736 16:49376371-49376393 TCCGCTCAGCTTCCCCAAAATGG + Intronic
1138529685 16:57628293-57628315 TCCCCAAAGTTCCCACAGAGAGG - Intronic
1139393342 16:66620317-66620339 TCCCCTCTGCTCCCACAGAGAGG - Intronic
1141034919 16:80618532-80618554 TCCCCAGAGCCCCCACCGAATGG - Intronic
1141403227 16:83769323-83769345 TCCCCACCGTTCCCCTAGATAGG - Intronic
1142077435 16:88128249-88128271 TCCTGACAGCCCCCCGAGAAAGG - Intergenic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1203093278 16_KI270728v1_random:1229981-1230003 CCCCCACACCTCCCCCACAAAGG + Intergenic
1142619548 17:1156100-1156122 TCCCCACAGCACCCCCATTGAGG - Intronic
1142992319 17:3739639-3739661 TGTCCTCAGCTACCCCAGAAGGG - Intronic
1143520419 17:7441191-7441213 ACCCTACAGCTCAACCAGAAGGG - Intronic
1144122167 17:12165704-12165726 TTCCCACAGCTCCACTAGTATGG + Intergenic
1144582510 17:16466900-16466922 TCCCCACAGCACCCCTAAAATGG - Intronic
1144781253 17:17809707-17809729 TCCCTGCAGCTCCCCAAGATAGG + Intronic
1145237513 17:21219214-21219236 TCCCCACAGCTGTGCCAGCATGG + Intergenic
1147110209 17:38256629-38256651 TCCCCAGAGCTCCCGCAGCGCGG + Intergenic
1147153340 17:38531096-38531118 CCCCCCCACCTCCCCCACAAAGG + Exonic
1147649132 17:42051978-42052000 CCCCCACAGCTGCCCCCGAGTGG + Intronic
1147741243 17:42672111-42672133 CCCGCACAGCTCCCCCAGGTCGG + Exonic
1147833676 17:43315120-43315142 TCCCACAAGCTTCCCCAGAAGGG - Intergenic
1147862357 17:43530941-43530963 TCCCCCCAGCTACTCCTGAATGG - Intronic
1147923971 17:43935502-43935524 TGCCCACACCAACCCCAGAAGGG - Intergenic
1148053004 17:44778297-44778319 CCCCCTCAGCTCCACCAGTAGGG - Intronic
1148419299 17:47531790-47531812 TCCCCAGAGCTCCCGCAGCGCGG - Intronic
1148481116 17:47960089-47960111 TACACACAGCTGTCCCAGAAAGG + Intergenic
1149314238 17:55423251-55423273 TCCCAAGAGCTCCTCCAGATGGG + Intergenic
1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG + Intergenic
1150001011 17:61440026-61440048 TTCACACAGCTCCCTCACAATGG - Intergenic
1152363370 17:79842419-79842441 TCCGCACAGGTCCCCGAGAAGGG + Intergenic
1152802380 17:82336942-82336964 TCCCCCTAGCTCCCCCACAGAGG - Intergenic
1153095501 18:1397220-1397242 TCCCCACAGATGCCAAAGAACGG - Intergenic
1153833705 18:8945493-8945515 TCCCCATTGCTCCCACAGACAGG + Intergenic
1154412013 18:14146713-14146735 TCCCCACAGGGCTCCCAGAGGGG + Intergenic
1156369116 18:36456706-36456728 TCCCCAGAGCTCAACCAGGAAGG - Intronic
1156628477 18:38938985-38939007 CCCCCACATCCACCCCAGAAGGG - Intergenic
1157404332 18:47410530-47410552 GCTCCACAGCTCCCCTAGGAGGG + Intergenic
1159259350 18:65991769-65991791 TCCACACAATTCCTCCAGAATGG + Intergenic
1160667076 19:335925-335947 GCCCCACAGCTCCATCTGAACGG + Intronic
1160740358 19:682783-682805 CCGCCAGAGCTCCCCCAGAGTGG - Exonic
1161420673 19:4174643-4174665 CCCCCACAGACCCCCCAAAAGGG - Exonic
1163777254 19:19225698-19225720 TCCCCACTGCCCCCCAACAAGGG - Intronic
1163819424 19:19487554-19487576 CCCCCAGAGCTTCCCAAGAAGGG - Intronic
1163829537 19:19541123-19541145 GGCCCACAGCTCCCCGAGCAGGG - Exonic
1164750345 19:30649097-30649119 GCCCGACAGCTGCCCCAGACAGG + Intronic
1164908557 19:31986946-31986968 TCTCCACAGCTCCCCCAAGCAGG + Intergenic
1164989376 19:32673559-32673581 TCTCCAAAGCTTCCCCCGAAGGG + Intronic
1165309769 19:35022988-35023010 GCCCCCCAGCTCCCCCAGGGAGG + Intronic
1166169617 19:41018630-41018652 CCCCCACAGCCCACCCAAAATGG + Intergenic
1168102857 19:54150179-54150201 TCCCTGCAGCTGCCCCAGCAGGG - Intronic
925147005 2:1588400-1588422 TCCCCAAAGCTCTCCAAGAGGGG + Intergenic
926843640 2:17109335-17109357 GCCCCAGAGCTCCCAAAGAATGG - Intergenic
927756837 2:25715426-25715448 TTCCCACAGCCCCCCCAAACTGG - Intergenic
927873589 2:26639940-26639962 CCCCCACAGCCCCACGAGAAGGG + Intronic
929000595 2:37344328-37344350 TTCCCACAGCTCCTAAAGAAGGG - Intergenic
933897446 2:86824573-86824595 TCCCCACAGGACCCCAGGAAGGG - Intronic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
936657934 2:114509592-114509614 TCCATACAGCTCCCCCAGCTTGG + Intronic
940334697 2:152513700-152513722 TTACCACAGTTTCCCCAGAAAGG + Intronic
940913007 2:159225405-159225427 TCCCCACATCCCACCCGGAAGGG + Intronic
946404871 2:219486904-219486926 ACCCCACTGCTCCCCAAGGAGGG - Intronic
946766469 2:223045267-223045289 TCCCCACATCTTCCCCAGGAAGG + Intergenic
947796662 2:232897344-232897366 TCCTCCCAGGTCCCCCAGAAAGG + Intronic
948687383 2:239677644-239677666 TCCCCACACCTCCTCCAGGGGGG + Intergenic
948789523 2:240370109-240370131 TCCCCACAGCCCCCACCGCAGGG - Intergenic
949023172 2:241752761-241752783 CCCCCACACCACCCCCAGGAGGG + Intronic
1168919610 20:1520447-1520469 TCTCCACAGCAACCCCATAAGGG - Intergenic
1171164606 20:22958903-22958925 TCCTCACAGGTCCCACAGGAGGG + Intergenic
1171300451 20:24055309-24055331 TCCCAGCAGAGCCCCCAGAATGG - Intergenic
1173549543 20:43923103-43923125 TCCCCAAAGCACCCCTACAATGG - Intronic
1173565773 20:44037395-44037417 TCCTCACAGCTGCCCCATGAGGG + Intronic
1174527540 20:51185532-51185554 TCCTCACAGCTCCTTCAGATTGG - Intergenic
1175166665 20:57048887-57048909 TCCCCCAAGCTCCTCCAGAGGGG - Intergenic
1175222724 20:57426626-57426648 CTCCCACAGCACCCCCAGGAGGG + Intergenic
1175624869 20:60481868-60481890 TCCCCGCACCTCCACCACAATGG + Intergenic
1175924605 20:62465670-62465692 ACCCCACACCCCCCCCAGCAAGG + Intronic
1176648734 21:9527148-9527170 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1176861020 21:14011614-14011636 TCCCCACAGGGCTCCCAGAGGGG - Intergenic
1177960487 21:27660463-27660485 TCCCCACATTTCCCCAAGAGAGG - Intergenic
1179610966 21:42549651-42549673 TGCCCTCAGCTCCCTCAGGAAGG - Intronic
1180032915 21:45224490-45224512 TCCCCACAGCTGCCCCACCCAGG - Exonic
1180982285 22:19884504-19884526 TGCCAACAGCTCCCCATGAAGGG - Intronic
1181390443 22:22576629-22576651 TCCCCACTTCTCCCTTAGAAGGG - Intergenic
1182145223 22:27993273-27993295 CACCCACAGCTCACCCAGCAGGG + Exonic
1182520429 22:30881722-30881744 TCCCCACAGCACAGCCAGGATGG + Intronic
1183472509 22:38017059-38017081 GCCCCACAGCTGCCTCAGGAGGG - Intronic
1183672284 22:39280129-39280151 TCCTCACAACCACCCCAGAATGG + Intergenic
1183758249 22:39790815-39790837 TTCCCACTGCTTCCCCACAAGGG + Intronic
1183819216 22:40331462-40331484 TCCTCAGAGCTCCCCCAAAGAGG + Exonic
1184093004 22:42302117-42302139 GCCCCTCAGCTCTCCCAGACTGG - Intronic
1184501588 22:44878025-44878047 TTCCAACAGCTCCTCCAGAGGGG + Intergenic
1185159352 22:49213591-49213613 TCCCCACCTCTCCCCTAGATGGG + Intergenic
949507633 3:4742034-4742056 CCCTCACAGCTTCCGCAGAAGGG - Intronic
950491208 3:13306055-13306077 TCCCCTCAGCTGCCACAGAGGGG + Intergenic
952385198 3:32836111-32836133 CCCCGACAGCTCCCCCAGCAAGG + Intronic
952819474 3:37473467-37473489 TTCCCACAGCACCCCCAGGAGGG - Intronic
953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG + Intergenic
954137031 3:48586637-48586659 TCCCCACTGTTCCCACTGAATGG - Exonic
956389243 3:68753847-68753869 TCCCCAGAGCCTCCCCATAAAGG + Intronic
956527848 3:70184766-70184788 TTCCCAAAGATTCCCCAGAAAGG - Intergenic
958997575 3:100922698-100922720 TCCCCTCAGAGCCTCCAGAAAGG + Intronic
959732436 3:109619190-109619212 TCCCCACAGTGCCACCACAAAGG - Intergenic
960662097 3:120071617-120071639 TCTCCCCAGCACCCCCAGATGGG + Intronic
961052548 3:123759238-123759260 GCCCCACAACTATCCCAGAAGGG - Intronic
965770186 3:172173812-172173834 GCCCCACCCCTCCCCCAGACAGG - Intronic
966101038 3:176269344-176269366 TCCCCACACCTGACCCAGAAAGG - Intergenic
967603931 3:191421623-191421645 TCTCCCCAGCCCCCCCAAAATGG - Intergenic
968152055 3:196344648-196344670 TCCCCAAATATACCCCAGAATGG - Intergenic
969097743 4:4746716-4746738 TCTCCCCAGCTGCCCCAGCAAGG - Intergenic
969441205 4:7217807-7217829 TCCCCACGGCTCCCACAGGTCGG - Intronic
970999304 4:22304160-22304182 TTCCCACAGCTCCCTCAGTAGGG - Intergenic
975241668 4:72066870-72066892 TGCCTACAGCTCTCCCAGACTGG + Intronic
975913487 4:79297150-79297172 TCCCCACACCCTCCCCACAACGG - Intronic
976208764 4:82646426-82646448 TCCACAGAGCTACCCCAAAATGG - Intronic
977795415 4:101159036-101159058 TCCTCACAGTTCCCTAAGAAAGG + Intronic
979015910 4:115433563-115433585 TCATCACAGCTCTCTCAGAAGGG + Intergenic
980508965 4:133760039-133760061 TCCCCACCGCCCCCCAAAAAAGG + Intergenic
983116462 4:163823249-163823271 ACCTCACAGCTACCCCAGTAAGG + Intronic
985519576 5:367201-367223 TCCCCCCAGCTCCTCCAGGGTGG - Intronic
985657684 5:1140525-1140547 TCCCCACAGCTGTCCCTGGAGGG + Intergenic
989324767 5:40179279-40179301 TCACCACTGATCCCACAGAAAGG + Intergenic
991642686 5:68770482-68770504 TCTCCCCATCTCCCTCAGAAAGG + Intergenic
993029903 5:82694233-82694255 TCCTCAGAGTTCCCCCAGGAAGG + Intergenic
993784145 5:92107711-92107733 TCCCCACAACCCCCCGACAAGGG - Intergenic
998301116 5:141021655-141021677 TCATCAGAGCTCCCCAAGAATGG - Intergenic
998712541 5:144843242-144843264 TCCCCTCAGCACCCCTTGAAGGG + Intergenic
998888218 5:146717643-146717665 ACCCCAAAGCTTCCCCAAAATGG - Intronic
999431739 5:151530968-151530990 TCCCCATGGCTCCCCTGGAATGG - Intronic
1000003530 5:157162743-157162765 CACCCACAGCTCCACCAAAAAGG - Exonic
1001200768 5:169714190-169714212 TCCACAAAGCTCACTCAGAATGG + Exonic
1001299106 5:170520964-170520986 GCCCCACAGCAACCCAAGAAGGG - Intronic
1001441083 5:171743530-171743552 CCCTCACAGCTCCTCCTGAAGGG + Intergenic
1002419487 5:179138181-179138203 TCCCCACAGGAACCCCAGGAGGG - Intronic
1002456911 5:179350510-179350532 TTCCCACTTCTCCTCCAGAAGGG + Intergenic
1003140653 6:3468657-3468679 ACCCCACAGAACCCCCACAAGGG + Intergenic
1003260133 6:4509609-4509631 TCCCCCCTGTTCCCCCAGTAGGG + Intergenic
1003384342 6:5653597-5653619 TCCCCTCCGATCCCCCAGGAGGG - Intronic
1005946688 6:30600989-30601011 TCCCCACCCCTCCCCCAGCGTGG - Exonic
1006470595 6:34226647-34226669 GTCCCACAGGTCCCCCAGGAAGG - Intergenic
1007073067 6:39050189-39050211 TCCTCACAGCGCCCCCAGCCAGG + Intronic
1007462462 6:42028359-42028381 TCTCCACACCTCGCCCAGCATGG - Intronic
1007509994 6:42367519-42367541 TCCACACAGAGCCCCCAGCAGGG - Intronic
1007819973 6:44554044-44554066 TCACCAAGGCTCCCACAGAAAGG + Intergenic
1008581719 6:52914052-52914074 TCCTCACACCCCCCACAGAATGG - Intergenic
1010062994 6:71646311-71646333 TCCCTGCAGCTCTCCCAGACTGG + Intergenic
1010813959 6:80333004-80333026 ACCCCCTAGCTCCCCCAAAAAGG + Intronic
1013457307 6:110342277-110342299 TCCCAACAGCTCCCCAGGCATGG - Intronic
1014018512 6:116562459-116562481 TCAGAACAGCTTCCCCAGAATGG - Intergenic
1014886874 6:126792895-126792917 TCCTCTCAACTCCCCCAGATGGG + Intergenic
1018384078 6:163287321-163287343 TCCCCACTGCTCTTACAGAAGGG + Intronic
1018667890 6:166156264-166156286 TCCCCACAGCCCCCACAGTGGGG + Intergenic
1019188823 6:170238292-170238314 ACTCCACAGCTTCCTCAGAAAGG + Intergenic
1019395404 7:815773-815795 ACCCCACACATTCCCCAGAAGGG + Intergenic
1020112832 7:5457219-5457241 ACCACACAGCTGCCACAGAATGG - Intronic
1020180689 7:5920193-5920215 TTCCCTCAGCTCCCCCCGAATGG + Intronic
1020276538 7:6628143-6628165 CCCCCACACCTCCCCCATGAAGG + Intergenic
1020302241 7:6804689-6804711 TTCCCTCAGCTCCCCCCGAATGG - Intronic
1022501312 7:30883782-30883804 GTTCCACTGCTCCCCCAGAAGGG - Intronic
1022799201 7:33759646-33759668 GGCCCTCATCTCCCCCAGAATGG + Intergenic
1023109217 7:36793186-36793208 TCCCCAGAGAGCCTCCAGAAAGG + Intergenic
1023362585 7:39431605-39431627 TCCCCCTAGCTCCCACAGCATGG - Intronic
1025275206 7:57576895-57576917 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1030529377 7:110693959-110693981 TCCCCTCTGTTCCCCAAGAAGGG - Intronic
1032079077 7:128849730-128849752 TCCCCACAGCACCCCCGAAGTGG + Intronic
1032446071 7:131984719-131984741 TCCTCACAACTCCACCAAAATGG + Intergenic
1032484018 7:132269403-132269425 TCTCCACAGCTCCACCAGACCGG + Intronic
1035056940 7:156041914-156041936 TCCCCACAGCTCTGCCGGCAAGG - Intergenic
1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG + Intronic
1035296982 7:157872869-157872891 TCTCCACAGCTCCCCTTCAAGGG + Intronic
1035357400 7:158284701-158284723 TACCCACACCTCCCGCAGGAAGG + Intronic
1035726545 8:1827884-1827906 TCCCCATCGCTCCCTCACAAGGG - Intronic
1038191533 8:25325526-25325548 TCCACAAAGCTCACCCAGAATGG + Exonic
1038265695 8:26038728-26038750 TCCCCCCAGCTACTCCAGCAAGG + Intronic
1038427645 8:27474579-27474601 ATCCCAAAGCTCTCCCAGAATGG + Intronic
1038451347 8:27641278-27641300 TCCCCATCCCTCCCCCAGACTGG + Intronic
1043448261 8:80340468-80340490 CCTCCACAGCTTCCCCAGATGGG + Intergenic
1047914241 8:129565112-129565134 TCCCCACATGCCCCCCAGAGTGG - Intergenic
1048426393 8:134327936-134327958 TCCCCACAGCTCCGCCATCTTGG + Intergenic
1049112524 8:140656608-140656630 CCCGCACTGCTCCCCAAGAAGGG - Intergenic
1049377689 8:142296798-142296820 TCCCCACAGGCTCCCCAGGACGG + Intronic
1049636874 8:143693812-143693834 TTCCCAGAGCTGCTCCAGAAAGG + Exonic
1049685358 8:143937229-143937251 TCCCCACAGCCCCGGGAGAAGGG - Exonic
1053104243 9:35396763-35396785 TCCTGACAGCTCCACCAGACTGG - Intronic
1054954494 9:70893183-70893205 TCCCCACAGGTCCTCCAGATTGG + Intronic
1056805973 9:89729097-89729119 TCCCCATAGCTTCCGCAGACTGG + Intergenic
1060852697 9:126890346-126890368 TCCACACAGAGCCCCCAGGAAGG - Intergenic
1061234704 9:129335663-129335685 TCCCCAGAGGTCCCCCAGAGAGG - Intergenic
1061448090 9:130653011-130653033 TCCCCAGAGCTCCCTTAGAGGGG - Intergenic
1061856034 9:133442510-133442532 GCCCCACAGCTCACCGAGCAGGG - Exonic
1062381591 9:136289575-136289597 CCCCCATGGCTCCCCCACAAGGG + Intronic
1062479106 9:136743260-136743282 TGTCCACATCTGCCCCAGAAGGG - Intronic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1062745499 9:138209198-138209220 TCACCACAGCTCCCCCCACATGG + Intergenic
1203626470 Un_KI270750v1:30698-30720 TCCCCACTTCAACCCCAGAAAGG + Intergenic
1186714428 X:12235220-12235242 CAGCCACATCTCCCCCAGAAGGG - Intronic
1187568687 X:20478472-20478494 TCCCCAGAACTCCCTCAGCATGG + Intergenic
1189639759 X:43055446-43055468 TCCAAACAGCACCCACAGAAGGG - Intergenic
1192088154 X:68122087-68122109 TCCCCACAGCTACCACAGCTGGG - Intronic
1194974954 X:100385216-100385238 TTCCCACAGCTTCACCAGATTGG + Intronic
1196106220 X:111898862-111898884 TCCCCACTCCTCCCCCACCAAGG + Intronic
1197404352 X:126030565-126030587 TCCCAACAGCTCCAGGAGAATGG - Intergenic