ID: 1107736780

View in Genome Browser
Species Human (GRCh38)
Location 13:43407056-43407078
Sequence AGTTATAATCATCAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107736780_1107736783 3 Left 1107736780 13:43407056-43407078 CCTTCCAGTTGATGATTATAACT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1107736783 13:43407082-43407104 GAAAAGAAATTAAGTTATACAGG 0: 1
1: 0
2: 4
3: 46
4: 521
1107736780_1107736784 17 Left 1107736780 13:43407056-43407078 CCTTCCAGTTGATGATTATAACT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1107736784 13:43407096-43407118 TTATACAGGAAGAGAGCAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 216
1107736780_1107736785 29 Left 1107736780 13:43407056-43407078 CCTTCCAGTTGATGATTATAACT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1107736785 13:43407108-43407130 AGAGCAGCTGGTCACACAAGAGG 0: 1
1: 0
2: 4
3: 23
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107736780 Original CRISPR AGTTATAATCATCAACTGGA AGG (reversed) Intronic
903318209 1:22525502-22525524 GGTTAGAAACATCAACTGGGAGG + Intronic
904143638 1:28372553-28372575 AGTTTTAATAATAAACTGGTTGG + Intronic
908849234 1:68357832-68357854 ACTTGTAATCCTCAACTGGGGGG + Intergenic
916384148 1:164248923-164248945 GCTTATAATCCTCCACTGGATGG + Intergenic
916451602 1:164926401-164926423 AGTTTTTGTCAGCAACTGGAAGG + Intergenic
919900589 1:202041446-202041468 TGTTATGTTTATCAACTGGAAGG - Intergenic
921465537 1:215482736-215482758 AGTTATGATCCACAACTGGAAGG + Intergenic
921661963 1:217814142-217814164 AGTTATAATCATTAACCTAAGGG + Intronic
921748049 1:218760034-218760056 AGATTTCAACATCAACTGGATGG + Intergenic
922244755 1:223785076-223785098 AATAACAATCATCAACTGGCAGG + Intronic
1064175399 10:13071059-13071081 ATTTATTTTCATCACCTGGAAGG - Intronic
1069120114 10:64559190-64559212 AGTTATTATCATGAACTGACAGG + Intergenic
1069779533 10:70946025-70946047 AGTAATATTCACCAAGTGGAGGG + Intergenic
1071680466 10:87699965-87699987 AGTGATAATAATCATCTTGAAGG - Intronic
1071687112 10:87770376-87770398 AGTCATAATCATCTACTAGAGGG + Intronic
1079513621 11:21240369-21240391 AGTTATAATCCTGAAGTGGGAGG + Intronic
1079930006 11:26546698-26546720 AATGATATTCATCAACTAGAGGG + Intronic
1088477873 11:110262708-110262730 AATTATAATCATAAACTAGAAGG + Intronic
1089031231 11:115331536-115331558 AGTAGGAGTCATCAACTGGATGG - Intronic
1090422742 11:126586837-126586859 AGTTTTTATCCTCACCTGGATGG - Intronic
1093285423 12:17253907-17253929 ATTTATAAGAATCAACTGGGTGG + Intergenic
1093415021 12:18909713-18909735 AGTTATAGTCATTTAATGGATGG - Intergenic
1095046568 12:37513886-37513908 AGTTTGAAACAGCAACTGGAAGG - Intergenic
1095426137 12:42076361-42076383 AATTATAATGATCAAATGGCAGG + Intergenic
1096487112 12:51990716-51990738 AGGTGTATTCATCAACTGCAGGG - Intronic
1096780667 12:53990264-53990286 AATCATAATCCTCAAATGGATGG + Exonic
1099320101 12:81136043-81136065 AGTAATACTTATCAAATGGATGG + Intronic
1101323388 12:103693503-103693525 GGATATAATCAAGAACTGGAGGG + Intronic
1101508954 12:105375516-105375538 AGGTATAATCATCAGCTGCTTGG + Intronic
1102655251 12:114477481-114477503 AGTTATAATCATTAACAACAGGG + Intergenic
1104163102 12:126199781-126199803 AGTCATAAACATCAGCTGGCAGG - Intergenic
1106115926 13:26817563-26817585 ATTTATAATCATTCACTGGCAGG + Intergenic
1107736780 13:43407056-43407078 AGTTATAATCATCAACTGGAAGG - Intronic
1108789657 13:53952311-53952333 AGTTTTAAAGATCATCTGGATGG - Intergenic
1109030920 13:57186031-57186053 AGTTATACTCACAAAGTGGAAGG + Intergenic
1110042338 13:70778957-70778979 CTTTATACTAATCAACTGGAGGG + Intergenic
1110059227 13:71020568-71020590 AGTTATAATCAACAAATGCAAGG + Intergenic
1118660771 14:68008219-68008241 ATTTATAATCAGCAAGAGGATGG + Intronic
1121504113 14:94463150-94463172 ATTTGTAATCATCATCAGGAAGG + Exonic
1123723847 15:23083253-23083275 AGTAAGAACCATCAACAGGAAGG + Intergenic
1124139046 15:27061524-27061546 AGTTTAAATCATAATCTGGAGGG - Intronic
1125660141 15:41387667-41387689 AGTTATAATCATCACCTGATGGG - Intronic
1128263223 15:66247282-66247304 ATTTATAATCATCTAATGCAGGG - Intronic
1129149705 15:73680631-73680653 AGTTATAATGTTCTACTGTATGG + Intergenic
1129875905 15:78975460-78975482 TGTAATAATCATGGACTGGAAGG - Intronic
1130409641 15:83634129-83634151 AGTTGTTATCATCATCTGCATGG + Intergenic
1131456355 15:92585426-92585448 AATTCTAACCTTCAACTGGAGGG - Intergenic
1131573045 15:93558726-93558748 TTTTCTAATCATCTACTGGACGG - Intergenic
1133243219 16:4428739-4428761 AGATAGAGTCATCAACTGGTTGG + Intronic
1134391024 16:13820176-13820198 ACTTCAAATCATCAAATGGACGG - Intergenic
1138959810 16:62015669-62015691 AGTTCTAATCTTCAATTTGATGG + Intronic
1147856617 17:43485255-43485277 AGATAAAGTCATCAACCGGAGGG + Intronic
1149520502 17:57314966-57314988 GGTTAGAATCATCAAGCGGAGGG + Intronic
1156839608 18:41595644-41595666 AAGTAGAATCATCAACAGGATGG - Intergenic
1158338305 18:56437191-56437213 AGTTATAATTTTAAATTGGAAGG - Intergenic
1166624249 19:44335359-44335381 AGTTATAATCTTAGACTGGGAGG + Intronic
929352631 2:40976933-40976955 ATTTATAATAAAAAACTGGAGGG + Intergenic
930351091 2:50255339-50255361 AGTTATAATCTTCACATGGGTGG - Intronic
935397672 2:102624984-102625006 AGGCATATTCATCAACTGGTTGG + Intronic
935667260 2:105523530-105523552 AGGAATAATAATCAGCTGGAGGG + Intergenic
936994955 2:118403667-118403689 AGATATAATCATGCATTGGATGG + Intergenic
938746402 2:134282387-134282409 AGTTATACACATCAACTCAAAGG - Intronic
939331510 2:140768481-140768503 ATTTATTATCTTCAACTTGAGGG - Intronic
939644733 2:144683659-144683681 AAATATAATCATCAACTTGCTGG - Intergenic
940496756 2:154439114-154439136 ATTTATGTTCCTCAACTGGAAGG + Intronic
942477887 2:176347966-176347988 AGGTATAATTTTCAACTGCATGG + Intergenic
943679596 2:190754271-190754293 ATTTATAATCAGAAACTTGAAGG - Intergenic
946950937 2:224874205-224874227 AATTATAATCCCCAACTGTATGG + Intronic
1169510151 20:6255349-6255371 GGTTATAATTTGCAACTGGAAGG + Intergenic
1170089895 20:12579354-12579376 TGTTAGACTGATCAACTGGAAGG - Intergenic
1170207409 20:13813428-13813450 AGATATAATCATTAACAGGTTGG + Intronic
1171541129 20:25957516-25957538 AGTTTGAAACAGCAACTGGAAGG - Intergenic
1171789917 20:29513635-29513657 AGTTATATCCATCAGATGGAGGG - Intergenic
1171799938 20:29602824-29602846 AGTTTGAAACAGCAACTGGAAGG + Intergenic
1171844147 20:30253861-30253883 AGTTTGAAACAGCAACTGGAAGG - Intergenic
1173414722 20:42845419-42845441 AATTATAATCATAAATTGAAGGG + Intronic
949741060 3:7235150-7235172 AGTTACTACCATCAACTAGACGG + Intronic
950379441 3:12598813-12598835 AGTTAAAAGCATCAAATGAATGG - Intronic
955190555 3:56757488-56757510 AGTTATAATTACCTGCTGGATGG + Intronic
955660311 3:61292062-61292084 GGTTATAATGATCTACTGAAGGG - Intergenic
955672641 3:61418049-61418071 TGTTACAATCATCAAATGTATGG - Intergenic
957290348 3:78270562-78270584 TGTTATAACCATAAACTGGGTGG - Intergenic
957298415 3:78360916-78360938 GATTTTAATAATCAACTGGATGG - Intergenic
957549944 3:81691228-81691250 ATATATTATCATTAACTGGAAGG - Intronic
958772849 3:98446847-98446869 ATTTATATTCATAAACTTGATGG - Intergenic
961473108 3:127130407-127130429 AATTATAATCTTCAATTAGAAGG + Intergenic
963973855 3:151459380-151459402 GGTTGTAATAATCCACTGGAAGG + Intergenic
965533564 3:169801311-169801333 AGTCTTAGTGATCAACTGGATGG - Intronic
965829661 3:172770873-172770895 AATTATAATTACCAAATGGAAGG + Intronic
966047087 3:175565443-175565465 AATTATAATCATGAAATGGATGG + Intronic
967473769 3:189892050-189892072 AGTTATAAGCAAAAACTGCAGGG + Intronic
974533081 4:63137396-63137418 AATTTTAATCATCAACTTGCTGG + Intergenic
975467677 4:74727688-74727710 AGTTAAATTTATAAACTGGAGGG + Intergenic
975967864 4:79996978-79997000 TGTTATTATCATCATCAGGAAGG + Intronic
977911586 4:102543415-102543437 AGTTATAAATATCAAATGCAAGG + Intronic
979940853 4:126760551-126760573 AGTTATAATAAACAACAGAAGGG + Intergenic
981005619 4:139872132-139872154 AGTTACAATGATCAAATGCAAGG - Intronic
984897089 4:184550515-184550537 AGTTTGAAACAGCAACTGGAAGG + Intergenic
988122162 5:26979471-26979493 AGTTATAAAGAACAACTGGGGGG + Intronic
990476357 5:56164861-56164883 ATTTATAATCATGAACGTGAAGG - Intronic
990678060 5:58210897-58210919 TTTTATAACCATCAACTAGATGG - Intergenic
992521317 5:77554731-77554753 AGTTATAAAGAGCAACAGGAAGG + Intronic
993433657 5:87863727-87863749 AGTTATAATCATGGAATAGACGG - Intergenic
994079697 5:95694548-95694570 AGGTATCATCATCAACTTGCTGG - Intronic
995171914 5:109124284-109124306 TGTTATAATAAGCAATTGGAAGG + Intronic
996660031 5:125991330-125991352 TGTGATAATGATCAACTGCATGG + Intergenic
999770564 5:154772493-154772515 AGTTTCAAGCATCTACTGGAGGG - Intronic
1005366434 6:25082936-25082958 AGTTATAATTATAAGCTAGAAGG - Intergenic
1008352663 6:50510853-50510875 AATTATAATCATCAAATGTAAGG - Intergenic
1009585794 6:65600034-65600056 AGTGATCTTCATCAAGTGGAAGG + Intronic
1013147528 6:107409272-107409294 AGTTATAAAAATCAAGAGGATGG - Intronic
1016713695 6:147201645-147201667 ATTTATGAGCATGAACTGGAGGG - Intergenic
1021674386 7:23065449-23065471 AGTGATCTTCCTCAACTGGATGG - Intergenic
1022864948 7:34407934-34407956 AGTTATAATCATAGATTTGAAGG - Intergenic
1025292567 7:57743752-57743774 AGTTTGAAACAGCAACTGGAAGG - Intergenic
1027611392 7:80365686-80365708 AGGTATAAAAATCAACTGGATGG + Intergenic
1028085093 7:86626358-86626380 ATTTATAATCATTCACTAGATGG + Intergenic
1029234899 7:99106978-99107000 AGTTATAATTATTAACCAGATGG + Intronic
1036176852 8:6547488-6547510 ATTTTTACTCAACAACTGGAAGG + Intronic
1039505140 8:38046588-38046610 AGTTATTATCATGACCTGCAGGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1042344289 8:67711810-67711832 AGTTTTAAACATCAAGTGGAAGG + Intronic
1042880002 8:73476934-73476956 AGTTCTAATTAACAACTGCAGGG + Intronic
1043237719 8:77889775-77889797 AGACATACTCAGCAACTGGAGGG - Intergenic
1045275638 8:100702490-100702512 CAATATAATCATCAACTGGCAGG + Intronic
1046482058 8:114835005-114835027 AGTGATAAGCAACAGCTGGAAGG + Intergenic
1047479140 8:125264294-125264316 GGTTATAACCCTCAACAGGATGG + Intronic
1052657647 9:31383345-31383367 AGTTCTAGTCATGAACAGGACGG - Intergenic
1054163950 9:61701971-61701993 AGTTTGAAACAGCAACTGGAAGG + Intergenic
1056102566 9:83313716-83313738 AGTTAAATTCAGCAACTGGTGGG + Exonic
1056991669 9:91418547-91418569 ATTTATAATCATCCACTGACTGG - Intronic
1186108902 X:6234959-6234981 ATTTAAAATAATCAAATGGAAGG - Intergenic
1187346336 X:18468181-18468203 AATTATAATCAGCAAATGAATGG + Intronic
1189353625 X:40295590-40295612 AGTTATATTCATCAACAGATTGG - Intergenic
1189597617 X:42586200-42586222 TGATATACTCAACAACTGGATGG + Intergenic
1190600353 X:52086056-52086078 AGATATAATCAGAAACTGCAAGG - Intergenic
1190935483 X:54995432-54995454 ATTTATACACAACAACTGGAGGG - Intronic
1192148984 X:68700185-68700207 AGTCATCATCATCAACTGCCAGG - Intronic
1194181984 X:90722424-90722446 AGTTATAATCTCCAAATGTATGG + Intergenic
1195873084 X:109506830-109506852 ATTTAAAATCATAGACTGGACGG + Intergenic
1196918494 X:120562422-120562444 AGTTAGAATGATCAACAGGTTGG - Intronic
1199515096 X:148667425-148667447 AGTTGTAAACAGCAACTGGATGG - Intronic
1200528611 Y:4304334-4304356 AGTTATAATCTCCAAATGTATGG + Intergenic
1200969864 Y:9140228-9140250 ATTTATTTTCATCAACTGGCAGG - Intergenic
1202141134 Y:21724022-21724044 ATTTATTTTCATCAACTGGCAGG + Intergenic
1202145731 Y:21779777-21779799 ATTTATTTTCATCAACTGGCAGG - Intergenic